EMAIL THIS PAGE TO A FRIEND

FITM1

fat storage-inducing transmembrane protein 1

46 Gene Product Result for
Synonyms: FIT1
UniProtKB ID: A5D6W6, Q8IUQ7
Gene ID:
Human(161247) Summary: FIT1 belongs to an evolutionarily conserved family of proteins involved in fat storage (Kadereit et al., 2008 [PubMed 18160536]
Mouse(68680) fat storage-inducing transmembrane protein 1
Rat(290223) fat storage-inducing transmembrane protein 1
Zebrafish(503747) fat storage-inducing transmembrane protein 1
cow(510040) fat storage-inducing transmembrane protein 1
domestic cat(101099723) fat storage-inducing transmembrane protein 1
dog(608292) fat storage-inducing transmembrane protein 1
sheep(101120413) fat storage-inducing transmembrane protein 1
domestic guinea pig(100713122) fat storage-inducing transmembrane protein 1
naked mole-rat(101704075) fat storage-inducing transmembrane protein 1
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_203402 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_203402 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_203402 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_026808 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_026808 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_026808 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_203402 Rosetta Predictions human pricing
NM_001106037 Rosetta Predictions rat pricing
NM_026808 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_203402 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00029850 predicted 597
2 SASI_Hs01_00029851 predicted 420
3 SASI_Hs01_00029852 predicted 251
4 SASI_Hs01_00029853 predicted 358
5 SASI_Hs01_00029854 predicted 539
6 SASI_Hs01_00029855 predicted 366
7 SASI_Hs01_00029856 predicted 556
8 SASI_Hs01_00029859 predicted 601
9 SASI_Hs02_00373331 predicted 201
10 SASI_Hs02_00373332 predicted 362
11 SASI_Hs01_00029857 predicted 562
12 SASI_Hs01_00029858 predicted 364
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001106037 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00215002 predicted 325
2 SASI_Rn02_00215003 predicted 435
3 SASI_Rn02_00215004 predicted 447
4 SASI_Rn02_00215005 predicted 362
5 SASI_Rn02_00215006 predicted 544
6 SASI_Rn02_00215007 predicted 426
7 SASI_Rn02_00215008 predicted 610
8 SASI_Rn02_00215009 predicted 623
9 SASI_Rn02_00215010 predicted 272
10 SASI_Rn02_00215011 predicted 462
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_026808 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00094442 predicted 224
2 SASI_Mm01_00094443 predicted 256
3 SASI_Mm01_00094445 predicted 241
4 SASI_Mm01_00094446 predicted 363
5 SASI_Mm01_00094447 predicted 424
6 SASI_Mm01_00094448 predicted 265
7 SASI_Mm01_00094449 predicted 537
8 SASI_Mm01_00094450 predicted 552
9 SASI_Mm01_00094451 predicted 424
10 SASI_Mm02_00330941 predicted 334
11 SASI_Mm01_00094444 predicted 214
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_203402
FITM1 MISSION shRNA Bacterial Glycerol Stock
fat storage-inducing transmembrane protein 1
Human
11 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000166146    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_203402.1-251s1c1
Sequence:CCGGCCACGGCAACTTCTTCAACATCTCGAGATGTTGAAGAAGTTGCCGTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000164125    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_203402.1-722s1c1
Sequence:CCGGCGTCATCTATTTCCACCAGTACTCGAGTACTGGTGGAAATAGATGACGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000163772    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_203402.1-713s1c1
Sequence:CCGGGCTCTGTACCGTCATCTATTTCTCGAGAAATAGATGACGGTACAGAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000163965    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_203402.1-716s1c1
Sequence:CCGGCTGTACCGTCATCTATTTCCACTCGAGTGGAAATAGATGACGGTACAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000164632    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_203402.1-728s1c1
Sequence:CCGGCTATTTCCACCAGTACACTCACTCGAGTGAGTGTACTGGTGGAAATAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000165165    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_203402.1-701s1c1
Sequence:CCGGGAACTTCTTGCTGCTCTGTACCTCGAGGTACAGAGCAGCAAGAAGTTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000165255    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_203402.1-110s1c1
Sequence:CCGGGCTGTACTTTGGAAGCGAACACTCGAGTGTTCGCTTCCAAAGTACAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000165228    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_203402.1-209s1c1
Sequence:CCGGGCTTCTGCAGTTCCATGTCAACTCGAGTTGACATGGAACTGCAGAAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000446551    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_203402.2-654s21c1
Sequence:CCGGCACACCTTCCTGCTCACCTTTCTCGAGAAAGGTGAGCAGGAAGGTGTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000438399    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_203402.2-955s21c1
Sequence:CCGGACTCCAGCCGCAAGCATAACTCTCGAGAGTTATGCTTGCGGCTGGAGTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000438435    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_203402.2-698s21c1
Sequence:CCGGAGCAGCTGTGTTCGCCAAGTACTCGAGTACTTGGCGAACACAGCTGCTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_203402
FITM1 MISSION shRNA shRNA Plasmid DNA
fat storage-inducing transmembrane protein 1
Human
11 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000166146    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_203402.1-251s1c1
Sequence:CCGGCCACGGCAACTTCTTCAACATCTCGAGATGTTGAAGAAGTTGCCGTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000164125    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_203402.1-722s1c1
Sequence:CCGGCGTCATCTATTTCCACCAGTACTCGAGTACTGGTGGAAATAGATGACGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000163772    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_203402.1-713s1c1
Sequence:CCGGGCTCTGTACCGTCATCTATTTCTCGAGAAATAGATGACGGTACAGAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000163965    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_203402.1-716s1c1
Sequence:CCGGCTGTACCGTCATCTATTTCCACTCGAGTGGAAATAGATGACGGTACAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000164632    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_203402.1-728s1c1
Sequence:CCGGCTATTTCCACCAGTACACTCACTCGAGTGAGTGTACTGGTGGAAATAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000165165    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_203402.1-701s1c1
Sequence:CCGGGAACTTCTTGCTGCTCTGTACCTCGAGGTACAGAGCAGCAAGAAGTTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000165255    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_203402.1-110s1c1
Sequence:CCGGGCTGTACTTTGGAAGCGAACACTCGAGTGTTCGCTTCCAAAGTACAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000165228    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_203402.1-209s1c1
Sequence:CCGGGCTTCTGCAGTTCCATGTCAACTCGAGTTGACATGGAACTGCAGAAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000446551    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_203402.2-654s21c1
Sequence:CCGGCACACCTTCCTGCTCACCTTTCTCGAGAAAGGTGAGCAGGAAGGTGTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000438399    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_203402.2-955s21c1
Sequence:CCGGACTCCAGCCGCAAGCATAACTCTCGAGAGTTATGCTTGCGGCTGGAGTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000438435    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_203402.2-698s21c1
Sequence:CCGGAGCAGCTGTGTTCGCCAAGTACTCGAGTACTTGGCGAACACAGCTGCTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_203402
FITM1 MISSION shRNA Lentiviral Transduction Particles
fat storage-inducing transmembrane protein 1
Human
11 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000166146    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_203402.1-251s1c1
Sequence:CCGGCCACGGCAACTTCTTCAACATCTCGAGATGTTGAAGAAGTTGCCGTGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000164125    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_203402.1-722s1c1
Sequence:CCGGCGTCATCTATTTCCACCAGTACTCGAGTACTGGTGGAAATAGATGACGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000163772    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_203402.1-713s1c1
Sequence:CCGGGCTCTGTACCGTCATCTATTTCTCGAGAAATAGATGACGGTACAGAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000163965    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_203402.1-716s1c1
Sequence:CCGGCTGTACCGTCATCTATTTCCACTCGAGTGGAAATAGATGACGGTACAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000164632    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_203402.1-728s1c1
Sequence:CCGGCTATTTCCACCAGTACACTCACTCGAGTGAGTGTACTGGTGGAAATAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000165165    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_203402.1-701s1c1
Sequence:CCGGGAACTTCTTGCTGCTCTGTACCTCGAGGTACAGAGCAGCAAGAAGTTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000165255    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_203402.1-110s1c1
Sequence:CCGGGCTGTACTTTGGAAGCGAACACTCGAGTGTTCGCTTCCAAAGTACAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000165228    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_203402.1-209s1c1
Sequence:CCGGGCTTCTGCAGTTCCATGTCAACTCGAGTTGACATGGAACTGCAGAAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000446551    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_203402.2-654s21c1
Sequence:CCGGCACACCTTCCTGCTCACCTTTCTCGAGAAAGGTGAGCAGGAAGGTGTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000438399    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_203402.2-955s21c1
Sequence:CCGGACTCCAGCCGCAAGCATAACTCTCGAGAGTTATGCTTGCGGCTGGAGTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000438435    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_203402.2-698s21c1
Sequence:CCGGAGCAGCTGTGTTCGCCAAGTACTCGAGTACTTGGCGAACACAGCTGCTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_026808
FITM1 MISSION shRNA Bacterial Glycerol Stock
fat storage-inducing transmembrane protein 1
Mouse
4 Products Total
TRC Number Price Set Price (4)? Select
TRCN0000173704    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026808.1-737s1c1
Sequence:CCGGCCATCAATATACCCACAAGGTCTCGAGACCTTGTGGGTATATTGATGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000173680    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026808.1-212s1c1
Sequence:CCGGCCTTCTGCAGTTTCACGTTAACTCGAGTTAACGTGAAACTGCAGAAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000194575    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026808.1-719s1c1
Sequence:CCGGCTGCACGGTCATCTATTTCCACTCGAGTGGAAATAGATGACCGTGCAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000193322    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026808.1-731s1c1
Sequence:CCGGCTATTTCCATCAATATACCCACTCGAGTGGGTATATTGATGGAAATAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_026808
FITM1 MISSION shRNA shRNA Plasmid DNA
fat storage-inducing transmembrane protein 1
Mouse
4 Products Total
TRC Number Vector Price Set Price (4)? Select
TRCN0000173704    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026808.1-737s1c1
Sequence:CCGGCCATCAATATACCCACAAGGTCTCGAGACCTTGTGGGTATATTGATGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000173680    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026808.1-212s1c1
Sequence:CCGGCCTTCTGCAGTTTCACGTTAACTCGAGTTAACGTGAAACTGCAGAAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000194575    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026808.1-719s1c1
Sequence:CCGGCTGCACGGTCATCTATTTCCACTCGAGTGGAAATAGATGACCGTGCAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000193322    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026808.1-731s1c1
Sequence:CCGGCTATTTCCATCAATATACCCACTCGAGTGGGTATATTGATGGAAATAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_026808
FITM1 MISSION shRNA Lentiviral Transduction Particles
fat storage-inducing transmembrane protein 1
Mouse
4 Products Total
TRC Number Volume Titer Vector Price Set Price (4)? Select
TRCN0000173704    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026808.1-737s1c1
Sequence:CCGGCCATCAATATACCCACAAGGTCTCGAGACCTTGTGGGTATATTGATGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000173680    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026808.1-212s1c1
Sequence:CCGGCCTTCTGCAGTTTCACGTTAACTCGAGTTAACGTGAAACTGCAGAAGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000194575    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026808.1-719s1c1
Sequence:CCGGCTGCACGGTCATCTATTTCCACTCGAGTGGAAATAGATGACCGTGCAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000193322    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026808.1-731s1c1
Sequence:CCGGCTATTTCCATCAATATACCCACTCGAGTGGGTATATTGATGGAAATAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)