EMAIL THIS PAGE TO A FRIEND

FITM2

fat storage-inducing transmembrane protein 2

58 Gene Product Result for
Synonyms: C20orf142 Fit2 dJ881L22.2
UniProtKB ID: Q8N6M3, A1L492, B9EGQ4, Q5TE59, Q9H3Y1
Gene ID:
Human(128486) Summary: FIT2 belongs to an evolutionarily conserved family of proteins involved in fat storage (Kadereit et al., 2008 [PubMed 18160536]
Mouse(228859) fat storage-inducing transmembrane protein 2
Rat(311617) fat storage-inducing transmembrane protein 2
naked mole-rat(101711358) fat storage-inducing transmembrane protein 2
domestic guinea pig(100713000) fat storage-inducing transmembrane protein 2
sheep(101108768) fat storage-inducing transmembrane protein 2
Zebrafish(552928) fat storage-inducing transmembrane protein 2
cow(518159) fat storage-inducing transmembrane protein 2
domestic cat(101093513) fat storage-inducing transmembrane protein 2
dog(485882) fat storage-inducing transmembrane protein 2
chicken(419200) fat storage-inducing transmembrane protein 2
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001080472 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001080472 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001080472 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_173397 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_173397 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_173397 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001080472 Rosetta Predictions human pricing
XM_371399 Rosetta Predictions human pricing
XM_932895 Rosetta Predictions human pricing
NM_001107799 Rosetta Predictions rat pricing
NM_173397 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001080472 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00315166 predicted 581
2 SASI_Hs02_00315167 predicted 258
3 SASI_Hs02_00315168 predicted 578
4 SASI_Hs02_00315169 predicted 542
5 SASI_Hs02_00315170 predicted 723
6 SASI_Hs02_00315171 predicted 684
7 SASI_Hs02_00315172 predicted 325
8 SASI_Hs02_00315173 predicted 689
9 SASI_Hs02_00315174 predicted 242
10 SASI_Hs02_00315175 predicted 479
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_371399 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00299413 predicted 590
2 SASI_Hs01_00299414 predicted 250
3 SASI_Hs01_00299415 predicted 381
4 SASI_Hs01_00299416 predicted 571
5 SASI_Hs01_00299417 predicted 544
6 SASI_Hs01_00299418 predicted 664
7 SASI_Hs01_00299419 predicted 684
8 SASI_Hs01_00299420 predicted 324
9 SASI_Hs01_00299421 predicted 689
10 SASI_Hs01_00299422 predicted 400
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_932895 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00296484 predicted 464
2 SASI_Hs01_00296485 predicted 398
3 SASI_Hs01_00296486 predicted 492
4 SASI_Hs01_00296487 predicted 373
5 SASI_Hs01_00296488 predicted 772
6 SASI_Hs01_00296489 predicted 550
7 SASI_Hs01_00296490 predicted 383
8 SASI_Hs01_00296491 predicted 411
9 SASI_Hs01_00296492 predicted 772
10 SASI_Hs01_00296493 predicted 765
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001107799 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00232385 predicted 1100
2 SASI_Rn02_00232386 predicted 1129
3 SASI_Rn02_00232387 predicted 1197
4 SASI_Rn02_00232388 predicted 889
5 SASI_Rn02_00232389 predicted 817
6 SASI_Rn02_00232390 predicted 977
7 SASI_Rn02_00232391 predicted 770
8 SASI_Rn02_00232392 predicted 751
9 SASI_Rn02_00232393 predicted 774
10 SASI_Rn02_00232394 predicted 959
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_173397 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00345236 predicted 887
2 SASI_Mm02_00345237 predicted 806
3 SASI_Mm02_00345238 predicted 764
4 SASI_Mm02_00345239 predicted 744
5 SASI_Mm02_00345240 predicted 872
6 SASI_Mm02_00345241 predicted 806
7 SASI_Mm02_00345242 predicted 541
8 SASI_Mm02_00345243 predicted 745
9 SASI_Mm02_00345244 predicted 888
10 SASI_Mm02_00345245 predicted 1140
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001080472
FITM2 MISSION shRNA Bacterial Glycerol Stock
fat storage-inducing transmembrane protein 2
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000239305    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080472.1-582s21c1
Sequence:CCGGTTCTGCGCCCTCATGATTGTACTCGAGTACAATCATGAGGGCGCAGAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000239306    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080472.1-745s21c1
Sequence:CCGGACTTGTCCCAGAAGGTGTTTGCTCGAGCAAACACCTTCTGGGACAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000239307    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080472.1-700s21c1
Sequence:CCGGTCATCTGGGTGTTGATGTTTCCTCGAGGAAACATCAACACCCAGATGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000239308    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080472.1-260s21c1
Sequence:CCGGCAACGTCCTCAACGTGTATTTCTCGAGAAATACACGTTGAGGACGTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000239309    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080472.1-325s21c1
Sequence:CCGGTCATTGCCCTCACCAACTACCCTCGAGGGTAGTTGGTGAGGGCAATGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001080472
FITM2 MISSION shRNA shRNA Plasmid DNA
fat storage-inducing transmembrane protein 2
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000239305    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080472.1-582s21c1
Sequence:CCGGTTCTGCGCCCTCATGATTGTACTCGAGTACAATCATGAGGGCGCAGAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000239306    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080472.1-745s21c1
Sequence:CCGGACTTGTCCCAGAAGGTGTTTGCTCGAGCAAACACCTTCTGGGACAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000239307    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080472.1-700s21c1
Sequence:CCGGTCATCTGGGTGTTGATGTTTCCTCGAGGAAACATCAACACCCAGATGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000239308    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080472.1-260s21c1
Sequence:CCGGCAACGTCCTCAACGTGTATTTCTCGAGAAATACACGTTGAGGACGTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000239309    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080472.1-325s21c1
Sequence:CCGGTCATTGCCCTCACCAACTACCCTCGAGGGTAGTTGGTGAGGGCAATGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001080472
FITM2 MISSION shRNA Lentiviral Transduction Particles
fat storage-inducing transmembrane protein 2
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000239305    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080472.1-582s21c1
Sequence:CCGGTTCTGCGCCCTCATGATTGTACTCGAGTACAATCATGAGGGCGCAGAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000239306    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080472.1-745s21c1
Sequence:CCGGACTTGTCCCAGAAGGTGTTTGCTCGAGCAAACACCTTCTGGGACAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000239307    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080472.1-700s21c1
Sequence:CCGGTCATCTGGGTGTTGATGTTTCCTCGAGGAAACATCAACACCCAGATGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000239308    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080472.1-260s21c1
Sequence:CCGGCAACGTCCTCAACGTGTATTTCTCGAGAAATACACGTTGAGGACGTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000239309    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080472.1-325s21c1
Sequence:CCGGTCATTGCCCTCACCAACTACCCTCGAGGGTAGTTGGTGAGGGCAATGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_173397
VALIDATED
FITM2 MISSION shRNA Bacterial Glycerol Stock
fat storage-inducing transmembrane protein 2
Mouse
4 Products Total
TRC Number Price Set Price (4)? Select
TRCN0000125380    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_173397.2-798s1c1
Sequence:CCGGCCAGAGTTGTAGTTTGACTTTCTCGAGAAAGTCAAACTACAACTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000125381    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_173397.2-386s1c1
Sequence:CCGGTCTCCAACATTGAGCACTATACTCGAGTATAGTGCTCAATGTTGGAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000125382    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173397.2-819s1c1
Sequence:CCGGGAAGCGAGATACTTACAAGAACTCGAGTTCTTGTAAGTATCTCGCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000125383    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173397.2-681s1c1
Sequence:CCGGAGCCGTTTATTTCCACGACTTCTCGAGAAGTCGTGGAAATAAACGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_173397
VALIDATED
FITM2 MISSION shRNA shRNA Plasmid DNA
fat storage-inducing transmembrane protein 2
Mouse
4 Products Total
TRC Number Vector Price Set Price (4)? Select
TRCN0000125380    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_173397.2-798s1c1
Sequence:CCGGCCAGAGTTGTAGTTTGACTTTCTCGAGAAAGTCAAACTACAACTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000125381    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_173397.2-386s1c1
Sequence:CCGGTCTCCAACATTGAGCACTATACTCGAGTATAGTGCTCAATGTTGGAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000125382    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173397.2-819s1c1
Sequence:CCGGGAAGCGAGATACTTACAAGAACTCGAGTTCTTGTAAGTATCTCGCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000125383    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173397.2-681s1c1
Sequence:CCGGAGCCGTTTATTTCCACGACTTCTCGAGAAGTCGTGGAAATAAACGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_173397
VALIDATED
FITM2 MISSION shRNA Lentiviral Transduction Particles
fat storage-inducing transmembrane protein 2
Mouse
4 Products Total
TRC Number Volume Titer Vector Price Set Price (4)? Select
TRCN0000125380    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_173397.2-798s1c1
Sequence:CCGGCCAGAGTTGTAGTTTGACTTTCTCGAGAAAGTCAAACTACAACTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000125381    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_173397.2-386s1c1
Sequence:CCGGTCTCCAACATTGAGCACTATACTCGAGTATAGTGCTCAATGTTGGAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000125382    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173397.2-819s1c1
Sequence:CCGGGAAGCGAGATACTTACAAGAACTCGAGTTCTTGTAAGTATCTCGCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000125383    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173397.2-681s1c1
Sequence:CCGGAGCCGTTTATTTCCACGACTTCTCGAGAAGTCGTGGAAATAAACGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks