EMAIL THIS PAGE TO A FRIEND

FIZ1

FLT3-interacting zinc finger 1

125 Gene Product Result for
Synonyms: ZNF798
UniProtKB ID: Q96SL8, A2RU72, Q6ZMJ7
Gene ID:
Human(84922) Summary: This gene encodes zinc finger protein, which interacts with a receptor tyrosine kinase involved in the regulation of hematopoietic and lymphoid cells. This gene product also interacts with a transcription factor that regulates the expression of rod-specific genes in retina. [provided by RefSeq, Jul 2008]
Mouse(23877) Flt3 interacting zinc finger protein 1
Rat(292584) FLT3-interacting zinc finger 1
domestic cat(101089060) FLT3-interacting zinc finger 1
cow(789631) FLT3-interacting zinc finger 1
dog(484292) FLT3-interacting zinc finger 1
sheep(101118724) FLT3-interacting zinc finger 1
domestic guinea pig(100732708) FLT3-interacting zinc finger 1
naked mole-rat(101700156) FLT3-interacting zinc finger 1
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_032836 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_032836 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_032836 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_011813 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_011813 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_011813 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EMU044501 MISSION® esiRNA esiRNA targeting mouse Fiz1 (esiRNA1) mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_032836 Rosetta Predictions human pricing
NM_001106223 Rosetta Predictions rat pricing
NM_001110328 Rosetta Predictions mouse pricing
NM_001110329 Rosetta Predictions mouse pricing
NM_001110330 Rosetta Predictions mouse pricing
NM_011813 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_032836 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00036296 predicted 2030
2 SASI_Hs02_00360429 predicted 1802
3 SASI_Hs01_00036299 predicted 1895
4 SASI_Hs02_00360430 predicted 1815
5 SASI_Hs02_00360431 predicted 1427
6 SASI_Hs01_00036300 predicted 240
7 SASI_Hs02_00360432 predicted 1152
8 SASI_Hs01_00036301 predicted 1981
9 SASI_Hs02_00360433 predicted 280
10 SASI_Hs01_00036303 predicted 1903
11 SASI_Hs01_00036297 predicted 821
12 SASI_Hs01_00036298 predicted 1926
13 SASI_Hs01_00036302 predicted 758
14 SASI_Hs01_00036304 predicted 1987
15 SASI_Hs01_00036305 predicted 764
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001106223 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00216848 predicted 631
2 SASI_Rn02_00216849 predicted 852
3 SASI_Rn02_00216850 predicted 1790
4 SASI_Rn02_00216851 predicted 842
5 SASI_Rn02_00216852 predicted 378
6 SASI_Rn02_00216853 predicted 1925
7 SASI_Rn02_00216854 predicted 1858
8 SASI_Rn02_00216855 predicted 1513
9 SASI_Rn02_00216856 predicted 1754
10 SASI_Rn02_00216857 predicted 1151
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001110328 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00305428 predicted 375
2 SASI_Mm02_00305429 predicted 356
3 SASI_Mm02_00305430 predicted 2003
4 SASI_Mm02_00305431 predicted 422
5 SASI_Mm02_00305432 predicted 521
6 SASI_Mm02_00305433 predicted 1875
7 SASI_Mm02_00305434 predicted 2179
8 SASI_Mm02_00305435 predicted 1788
9 SASI_Mm02_00305436 predicted 1855
10 SASI_Mm02_00305437 predicted 2188
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001110329 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00305438 predicted 318
2 SASI_Mm02_00305439 predicted 299
3 SASI_Mm02_00305440 predicted 1950
4 SASI_Mm02_00305441 predicted 360
5 SASI_Mm02_00305442 predicted 465
6 SASI_Mm02_00305443 predicted 1823
7 SASI_Mm02_00305444 predicted 2125
8 SASI_Mm02_00305445 predicted 1732
9 SASI_Mm02_00305446 predicted 1791
10 SASI_Mm02_00305447 predicted 2128
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001110330 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00305448 predicted 243
2 SASI_Mm02_00305449 predicted 236
3 SASI_Mm02_00305450 predicted 1885
4 SASI_Mm02_00305451 predicted 288
5 SASI_Mm02_00305452 predicted 392
6 SASI_Mm02_00305453 predicted 1749
7 SASI_Mm02_00305454 predicted 2051
8 SASI_Mm02_00305455 predicted 1654
9 SASI_Mm02_00305456 predicted 1727
10 SASI_Mm02_00305457 predicted 2056
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_011813 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00321501 predicted 361
2 SASI_Mm02_00321502 predicted 341
3 SASI_Mm01_00164433 predicted 1994
4 SASI_Mm02_00321503 predicted 399
5 SASI_Mm02_00321504 predicted 508
6 SASI_Mm01_00164435 predicted 1862
7 SASI_Mm02_00321505 predicted 2169
8 SASI_Mm02_00321506 predicted 1769
9 SASI_Mm02_00321507 predicted 1832
10 SASI_Mm01_00164437 predicted 2167
11 SASI_Mm01_00164431 predicted 285
12 SASI_Mm01_00164432 predicted 1429
13 SASI_Mm01_00164434 predicted 2105
14 SASI_Mm01_00164436 predicted 374
15 SASI_Mm01_00164438 predicted 867
16 SASI_Mm01_00164439 predicted 1239
17 SASI_Mm01_00164440 predicted 2142
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_032836
FIZ1 MISSION shRNA Bacterial Glycerol Stock
FLT3-interacting zinc finger 1
Human
6 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000107655    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_032836.1-2410s1c1
Sequence:CCGGCGCAATTCTTTATCCTGTGAACTCGAGTTCACAGGATAAAGAATTGCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000107656    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032836.1-273s1c1
Sequence:CCGGGCACAGCTTCAACCTAGCCAACTCGAGTTGGCTAGGTTGAAGCTGTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000107658    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032836.1-1443s1c1
Sequence:CCGGCCGCCACGAGTGCTACCTCAACTCGAGTTGAGGTAGCACTCGTGGCGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000107657    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032836.1-151s1c1
Sequence:CCGGGTCCCGTTTCACTGCAGTGAACTCGAGTTCACTGCAGTGAAACGGGACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000434634    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032836.2-1320s21c1
Sequence:CCGGCAAGAAGATCTTCGGCTGCTCCTCGAGGAGCAGCCGAAGATCTTCTTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000424273    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032836.2-384s21c1
Sequence:CCGGGGTCGTCCACACTGGTGAGAACTCGAGTTCTCACCAGTGTGGACGACCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_032836
FIZ1 MISSION shRNA shRNA Plasmid DNA
FLT3-interacting zinc finger 1
Human
6 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000107655    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_032836.1-2410s1c1
Sequence:CCGGCGCAATTCTTTATCCTGTGAACTCGAGTTCACAGGATAAAGAATTGCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000107656    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032836.1-273s1c1
Sequence:CCGGGCACAGCTTCAACCTAGCCAACTCGAGTTGGCTAGGTTGAAGCTGTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000107658    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032836.1-1443s1c1
Sequence:CCGGCCGCCACGAGTGCTACCTCAACTCGAGTTGAGGTAGCACTCGTGGCGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000107657    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032836.1-151s1c1
Sequence:CCGGGTCCCGTTTCACTGCAGTGAACTCGAGTTCACTGCAGTGAAACGGGACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000434634    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032836.2-1320s21c1
Sequence:CCGGCAAGAAGATCTTCGGCTGCTCCTCGAGGAGCAGCCGAAGATCTTCTTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000424273    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032836.2-384s21c1
Sequence:CCGGGGTCGTCCACACTGGTGAGAACTCGAGTTCTCACCAGTGTGGACGACCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_032836
FIZ1 MISSION shRNA Lentiviral Transduction Particles
FLT3-interacting zinc finger 1
Human
6 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000107655    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_032836.1-2410s1c1
Sequence:CCGGCGCAATTCTTTATCCTGTGAACTCGAGTTCACAGGATAAAGAATTGCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000107656    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032836.1-273s1c1
Sequence:CCGGGCACAGCTTCAACCTAGCCAACTCGAGTTGGCTAGGTTGAAGCTGTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000107658    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032836.1-1443s1c1
Sequence:CCGGCCGCCACGAGTGCTACCTCAACTCGAGTTGAGGTAGCACTCGTGGCGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000107657    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032836.1-151s1c1
Sequence:CCGGGTCCCGTTTCACTGCAGTGAACTCGAGTTCACTGCAGTGAAACGGGACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000434634    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032836.2-1320s21c1
Sequence:CCGGCAAGAAGATCTTCGGCTGCTCCTCGAGGAGCAGCCGAAGATCTTCTTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000424273    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032836.2-384s21c1
Sequence:CCGGGGTCGTCCACACTGGTGAGAACTCGAGTTCTCACCAGTGTGGACGACCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_011813
VALIDATED
FIZ1 MISSION shRNA Bacterial Glycerol Stock
FLT3-interacting zinc finger 1
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000096259    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.64 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011813.2-2241s1c1
Sequence:CCGGCCCATCCTGAACACTAGATTACTCGAGTAATCTAGTGTTCAGGATGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000096261    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011813.2-1478s1c1
Sequence:CCGGGAAAGGCATGTGTTGGTCCATCTCGAGATGGACCAACACATGCCTTTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000096262    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011813.2-1419s1c1
Sequence:CCGGGCAAGAAGATCTTTGGCTGTTCTCGAGAACAGCCAAAGATCTTCTTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000096263    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011813.2-282s1c1
Sequence:CCGGGCAAGAGTTTCCGTTACCGATCTCGAGATCGGTAACGGAAACTCTTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000096260    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011813.2-379s1c1
Sequence:CCGGGCATAGCTTCAACTTGGCTAACTCGAGTTAGCCAAGTTGAAGCTATGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000311274    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011813.3-1618s21c1
Sequence:CCGGCAAGGGCTTCATCACGCTTAGCTCGAGCTAAGCGTGATGAAGCCCTTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000305298    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.7 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_011813.3-2110s21c1
Sequence:CCGGGAAATCTGCCTTCCGCCAATTCTCGAGAATTGGCGGAAGGCAGATTTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000305235    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_011813.3-260s21c1
Sequence:CCGGCCCTTTCACTGTAGCGAATGTCTCGAGACATTCGCTACAGTGAAAGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000305297    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011813.3-920s21c1
Sequence:CCGGGAACGCCACAAGCTCACTCATCTCGAGATGAGTGAGCTTGTGGCGTTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000334372    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_011813.3-379s21c3
Sequence:CCGGGCATAGCTTCAACTTGGCTAACTCGAGTTAGCCAAGTTGAAGCTATGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_011813
VALIDATED
FIZ1 MISSION shRNA shRNA Plasmid DNA
FLT3-interacting zinc finger 1
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000096259    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.64 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011813.2-2241s1c1
Sequence:CCGGCCCATCCTGAACACTAGATTACTCGAGTAATCTAGTGTTCAGGATGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000096261    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011813.2-1478s1c1
Sequence:CCGGGAAAGGCATGTGTTGGTCCATCTCGAGATGGACCAACACATGCCTTTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000096262    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011813.2-1419s1c1
Sequence:CCGGGCAAGAAGATCTTTGGCTGTTCTCGAGAACAGCCAAAGATCTTCTTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000096263    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011813.2-282s1c1
Sequence:CCGGGCAAGAGTTTCCGTTACCGATCTCGAGATCGGTAACGGAAACTCTTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000096260    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011813.2-379s1c1
Sequence:CCGGGCATAGCTTCAACTTGGCTAACTCGAGTTAGCCAAGTTGAAGCTATGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000311274    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011813.3-1618s21c1
Sequence:CCGGCAAGGGCTTCATCACGCTTAGCTCGAGCTAAGCGTGATGAAGCCCTTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000305298    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.7 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_011813.3-2110s21c1
Sequence:CCGGGAAATCTGCCTTCCGCCAATTCTCGAGAATTGGCGGAAGGCAGATTTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000305235    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_011813.3-260s21c1
Sequence:CCGGCCCTTTCACTGTAGCGAATGTCTCGAGACATTCGCTACAGTGAAAGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000305297    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011813.3-920s21c1
Sequence:CCGGGAACGCCACAAGCTCACTCATCTCGAGATGAGTGAGCTTGTGGCGTTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000334372    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_011813.3-379s21c3
Sequence:CCGGGCATAGCTTCAACTTGGCTAACTCGAGTTAGCCAAGTTGAAGCTATGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_011813
VALIDATED
FIZ1 MISSION shRNA Lentiviral Transduction Particles
FLT3-interacting zinc finger 1
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000096259    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.64 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011813.2-2241s1c1
Sequence:CCGGCCCATCCTGAACACTAGATTACTCGAGTAATCTAGTGTTCAGGATGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000096261    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011813.2-1478s1c1
Sequence:CCGGGAAAGGCATGTGTTGGTCCATCTCGAGATGGACCAACACATGCCTTTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000096262    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011813.2-1419s1c1
Sequence:CCGGGCAAGAAGATCTTTGGCTGTTCTCGAGAACAGCCAAAGATCTTCTTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000096263    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011813.2-282s1c1
Sequence:CCGGGCAAGAGTTTCCGTTACCGATCTCGAGATCGGTAACGGAAACTCTTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000096260    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011813.2-379s1c1
Sequence:CCGGGCATAGCTTCAACTTGGCTAACTCGAGTTAGCCAAGTTGAAGCTATGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000311274    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011813.3-1618s21c1
Sequence:CCGGCAAGGGCTTCATCACGCTTAGCTCGAGCTAAGCGTGATGAAGCCCTTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000305298    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.7 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_011813.3-2110s21c1
Sequence:CCGGGAAATCTGCCTTCCGCCAATTCTCGAGAATTGGCGGAAGGCAGATTTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000305235    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_011813.3-260s21c1
Sequence:CCGGCCCTTTCACTGTAGCGAATGTCTCGAGACATTCGCTACAGTGAAAGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000305297    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011813.3-920s21c1
Sequence:CCGGGAACGCCACAAGCTCACTCATCTCGAGATGAGTGAGCTTGTGGCGTTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000334372    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_011813.3-379s21c3
Sequence:CCGGGCATAGCTTCAACTTGGCTAACTCGAGTTAGCCAAGTTGAAGCTATGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)