EMAIL THIS PAGE TO A FRIEND

FJX1

four jointed box 1 (Drosophila)

110 Gene Product Result for
UniProtKB ID: Q86VR8, B2RCA9, Q9UGK6
Gene ID:
Human(24147) Summary: The protein encoded by this gene is the human ortholog of mouse and Drosophila four-jointed gene product. The Drosophila protein is important for growth and differentiation of legs and wings, and for proper development of the eyes. The exact function of this gene in humans is not known. [provided by RefSeq, Jul 2008]
Mouse(14221) four jointed box 1 (Drosophila)
Rat(366140) four jointed box 1 (Drosophila)
dog(483425) four jointed box 1 (Drosophila)
cow(100297910) four jointed box 1 (Drosophila)
Horse(100067199) four jointed box 1 (Drosophila)
naked mole-rat(101700070) four jointed box 1 (Drosophila)
domestic guinea pig(101787040) four jointed box 1 (Drosophila)
sheep(101114387) four jointed box 1 (Drosophila)
Domestic Rabbit(100342683) four jointed box 1 (Drosophila)
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_014344 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_014344 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_014344 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_010218 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_010218 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_010218 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_014344 Rosetta Predictions human pricing
NM_001108955 Rosetta Predictions rat pricing
NM_010218 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_014344 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00235747 predicted 1177
2 SASI_Hs01_00235748 predicted 1174
3 SASI_Hs02_00345488 predicted 672
4 SASI_Hs01_00235749 predicted 1174
5 SASI_Hs01_00235750 predicted 1647
6 SASI_Hs01_00235751 predicted 1661
7 SASI_Hs01_00235752 predicted 1826
8 SASI_Hs01_00235753 predicted 1629
9 SASI_Hs02_00345489 predicted 1829
10 SASI_Hs01_00235754 predicted 979
11 SASI_Hs01_00235755 predicted 1222
12 SASI_Hs01_00235756 predicted 672
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001108955 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00243734 predicted 1177
2 SASI_Rn02_00243735 predicted 1380
3 SASI_Rn02_00243736 predicted 1243
4 SASI_Rn02_00243737 predicted 1311
5 SASI_Rn02_00243738 predicted 1000
6 SASI_Rn02_00243739 predicted 1073
7 SASI_Rn02_00243740 predicted 1302
8 SASI_Rn02_00243741 predicted 1207
9 SASI_Rn02_00243742 predicted 1548
10 SASI_Rn02_00243743 predicted 1469
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_010218 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00138111 predicted 2043
2 SASI_Mm01_00138112 predicted 1145
3 SASI_Mm01_00138113 predicted 1956
4 SASI_Mm01_00138114 predicted 1246
5 SASI_Mm01_00138115 predicted 1978
6 SASI_Mm01_00138116 predicted 1310
7 SASI_Mm01_00138117 predicted 1073
8 SASI_Mm01_00138118 predicted 1382
9 SASI_Mm01_00138119 predicted 1894
10 SASI_Mm01_00138120 predicted 1909
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_014344
FJX1 MISSION shRNA Bacterial Glycerol Stock
four jointed box 1 (Drosophila)
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000256017    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014344.3-1723s21c1
Sequence:CCGGTTGCACTGTAAGGCCAAGTACCTCGAGGTACTTGGCCTTACAGTGCAATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000256019    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_014344.3-2148s21c1
Sequence:CCGGGTTTGAGCCGTTGAGCTAATTCTCGAGAATTAGCTCAACGGCTCAAACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000256021    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014344.3-1500s21c1
Sequence:CCGGAGGCATGTGGGACAAGTATAACTCGAGTTATACTTGTCCCACATGCCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000256020    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014344.3-1530s21c1
Sequence:CCGGGTTGCAGTCAGTGTGCGTGTTCTCGAGAACACGCACACTGACTGCAACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000256018    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014344.3-1020s21c1
Sequence:CCGGCGAGGCCCTGTCTTACTATCTCTCGAGAGATAGTAAGACAGGGCCTCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000007321    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_014344.2-1645s1c1
Sequence:CCGGCGAGGCGAGAAGTGTAACATTCTCGAGAATGTTACACTTCTCGCCTCGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000007324    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014344.2-673s1c1
Sequence:CCGGCGGCATCAACCCGGAGCAGATCTCGAGATCTGCTCCGGGTTGATGCCGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000007323    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014344.2-1039s1c1
Sequence:CCGGCCGGCTCGTAAGCAACCTCTTCTCGAGAAGAGGTTGCTTACGAGCCGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000007322    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014344.2-985s1c1
Sequence:CCGGCCTAGTACAATGGACCGACTTCTCGAGAAGTCGGTCCATTGTACTAGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000011086    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014344.2-1127s1c1
Sequence:CCGGGCGCTGGTCTTTCTGGACAATCTCGAGATTGTCCAGAAAGACCAGCGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_014344
FJX1 MISSION shRNA shRNA Plasmid DNA
four jointed box 1 (Drosophila)
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000256017    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014344.3-1723s21c1
Sequence:CCGGTTGCACTGTAAGGCCAAGTACCTCGAGGTACTTGGCCTTACAGTGCAATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000256019    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_014344.3-2148s21c1
Sequence:CCGGGTTTGAGCCGTTGAGCTAATTCTCGAGAATTAGCTCAACGGCTCAAACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000256021    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014344.3-1500s21c1
Sequence:CCGGAGGCATGTGGGACAAGTATAACTCGAGTTATACTTGTCCCACATGCCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000256020    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014344.3-1530s21c1
Sequence:CCGGGTTGCAGTCAGTGTGCGTGTTCTCGAGAACACGCACACTGACTGCAACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000256018    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014344.3-1020s21c1
Sequence:CCGGCGAGGCCCTGTCTTACTATCTCTCGAGAGATAGTAAGACAGGGCCTCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000007321    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_014344.2-1645s1c1
Sequence:CCGGCGAGGCGAGAAGTGTAACATTCTCGAGAATGTTACACTTCTCGCCTCGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000007324    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014344.2-673s1c1
Sequence:CCGGCGGCATCAACCCGGAGCAGATCTCGAGATCTGCTCCGGGTTGATGCCGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000007323    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014344.2-1039s1c1
Sequence:CCGGCCGGCTCGTAAGCAACCTCTTCTCGAGAAGAGGTTGCTTACGAGCCGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000007322    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014344.2-985s1c1
Sequence:CCGGCCTAGTACAATGGACCGACTTCTCGAGAAGTCGGTCCATTGTACTAGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000011086    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014344.2-1127s1c1
Sequence:CCGGGCGCTGGTCTTTCTGGACAATCTCGAGATTGTCCAGAAAGACCAGCGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_014344
FJX1 MISSION shRNA Lentiviral Transduction Particles
four jointed box 1 (Drosophila)
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000256017    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014344.3-1723s21c1
Sequence:CCGGTTGCACTGTAAGGCCAAGTACCTCGAGGTACTTGGCCTTACAGTGCAATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000256019    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_014344.3-2148s21c1
Sequence:CCGGGTTTGAGCCGTTGAGCTAATTCTCGAGAATTAGCTCAACGGCTCAAACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000256021    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014344.3-1500s21c1
Sequence:CCGGAGGCATGTGGGACAAGTATAACTCGAGTTATACTTGTCCCACATGCCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000256020    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014344.3-1530s21c1
Sequence:CCGGGTTGCAGTCAGTGTGCGTGTTCTCGAGAACACGCACACTGACTGCAACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000256018    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014344.3-1020s21c1
Sequence:CCGGCGAGGCCCTGTCTTACTATCTCTCGAGAGATAGTAAGACAGGGCCTCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000007321    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_014344.2-1645s1c1
Sequence:CCGGCGAGGCGAGAAGTGTAACATTCTCGAGAATGTTACACTTCTCGCCTCGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000007324    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014344.2-673s1c1
Sequence:CCGGCGGCATCAACCCGGAGCAGATCTCGAGATCTGCTCCGGGTTGATGCCGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000007323    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014344.2-1039s1c1
Sequence:CCGGCCGGCTCGTAAGCAACCTCTTCTCGAGAAGAGGTTGCTTACGAGCCGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000007322    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014344.2-985s1c1
Sequence:CCGGCCTAGTACAATGGACCGACTTCTCGAGAAGTCGGTCCATTGTACTAGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000011086    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014344.2-1127s1c1
Sequence:CCGGGCGCTGGTCTTTCTGGACAATCTCGAGATTGTCCAGAAAGACCAGCGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_010218
FJX1 MISSION shRNA Bacterial Glycerol Stock
four jointed box 1 (Drosophila)
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000089428    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_010218.2-1902s1c1
Sequence:CCGGCGTTTGAGCTAATTCCTCTATCTCGAGATAGAGGAATTAGCTCAAACGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000089431    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010218.2-1120s1c1
Sequence:CCGGGTGAGCAACCTCTTCAGCTTACTCGAGTAAGCTGAAGAGGTTGCTCACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000089432    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010218.2-747s1c1
Sequence:CCGGCGGCATCAACCCAGAGCAGATCTCGAGATCTGCTCTGGGTTGATGCCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000089429    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010218.2-1073s1c1
Sequence:CCGGCCGATCTGATCCTCTTCGATTCTCGAGAATCGAAGAGGATCAGATCGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000089430    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010218.2-1201s1c1
Sequence:CCGGGCGTTGGTCTTTCTGGACAATCTCGAGATTGTCCAGAAAGACCAACGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_010218
FJX1 MISSION shRNA shRNA Plasmid DNA
four jointed box 1 (Drosophila)
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000089428    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_010218.2-1902s1c1
Sequence:CCGGCGTTTGAGCTAATTCCTCTATCTCGAGATAGAGGAATTAGCTCAAACGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000089431    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010218.2-1120s1c1
Sequence:CCGGGTGAGCAACCTCTTCAGCTTACTCGAGTAAGCTGAAGAGGTTGCTCACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000089432    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010218.2-747s1c1
Sequence:CCGGCGGCATCAACCCAGAGCAGATCTCGAGATCTGCTCTGGGTTGATGCCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000089429    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010218.2-1073s1c1
Sequence:CCGGCCGATCTGATCCTCTTCGATTCTCGAGAATCGAAGAGGATCAGATCGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000089430    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010218.2-1201s1c1
Sequence:CCGGGCGTTGGTCTTTCTGGACAATCTCGAGATTGTCCAGAAAGACCAACGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_010218
FJX1 MISSION shRNA Lentiviral Transduction Particles
four jointed box 1 (Drosophila)
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000089428    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_010218.2-1902s1c1
Sequence:CCGGCGTTTGAGCTAATTCCTCTATCTCGAGATAGAGGAATTAGCTCAAACGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000089431    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010218.2-1120s1c1
Sequence:CCGGGTGAGCAACCTCTTCAGCTTACTCGAGTAAGCTGAAGAGGTTGCTCACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000089432    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010218.2-747s1c1
Sequence:CCGGCGGCATCAACCCAGAGCAGATCTCGAGATCTGCTCTGGGTTGATGCCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000089429    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010218.2-1073s1c1
Sequence:CCGGCCGATCTGATCCTCTTCGATTCTCGAGAATCGAAGAGGATCAGATCGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000089430    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010218.2-1201s1c1
Sequence:CCGGGCGTTGGTCTTTCTGGACAATCTCGAGATTGTCCAGAAAGACCAACGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)