EMAIL THIS PAGE TO A FRIEND

FKBP10

FK506 binding protein 10, 65 kDa

59 Gene Product Result for
Synonyms: FKBP65 OI11 OI6 PPIASE hFKBP65
UniProtKB ID: Q96AY3, Q7Z3R4, Q9H3N3, Q9H6N5, Q9UF89
Gene ID:
Human(60681) Summary: The protein encoded by this gene belongs to the FKBP-type peptidyl-prolyl cis/trans isomerase (PPIase) family. This protein localizes to the endoplasmic reticulum and acts as a molecular chaperone. Alternatively spliced variants encoding different isoforms have been reported, but their biological validity has not been determined.[provided by RefSeq, Nov 2009]
Mouse(14230) FK506 binding protein 10
Rat(360627) FK506 binding protein 10
sheep(101108933) FK506 binding protein 10, 65 kDa
domestic guinea pig(100715122) FK506 binding protein 10, 65 kDa
naked mole-rat(101704504) FK506 binding protein 10, 65 kDa
chicken(427013) FK506 binding protein 10, 65 kDa
cow(535310) FK506 binding protein 10, 65 kDa
domestic cat(101089157) FK506 binding protein 10, 65 kDa
dog(490975) FK506 binding protein 10, 65 kDa
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Small Molecule - Inhibitor

Product # Description Species Add to Cart
 
S7388 N-Succinyl-Ala-Ala-Pro-Phe p-nitroanilide human pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_010221 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_010221 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_010221 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_021939 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_021939 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_021939 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_021939 Rosetta Predictions human pricing
NM_001014120 Rosetta Predictions rat pricing
NM_010221 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_021939 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00097270 predicted 1325
2 SASI_Hs01_00097271 predicted 644
3 SASI_Hs01_00097272 predicted 670
4 SASI_Hs01_00097273 predicted 1723
5 SASI_Hs02_00355251 predicted 604
6 SASI_Hs01_00097276 predicted 836
7 SASI_Hs01_00097277 predicted 478
8 SASI_Hs02_00355252 predicted 1174
9 SASI_Hs02_00355253 predicted 756
10 SASI_Hs02_00355254 predicted 1248
11 SASI_Hs01_00097268 predicted 1027
12 SASI_Hs01_00097269 predicted 2071
13 SASI_Hs01_00097274 predicted 2042
14 SASI_Hs01_00097275 predicted 803
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001014120 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00122177 predicted 568
2 SASI_Rn01_00122178 predicted 992
3 SASI_Rn01_00122179 predicted 1813
4 SASI_Rn02_00201563 predicted 548
5 SASI_Rn01_00122180 predicted 359
6 SASI_Rn01_00122181 predicted 1684
7 SASI_Rn01_00122182 predicted 1609
8 SASI_Rn01_00122184 predicted 1693
9 SASI_Rn02_00201564 predicted 1109
10 SASI_Rn01_00122185 predicted 942
11 SASI_Rn01_00122183 predicted 1497
12 SASI_Rn01_00122186 predicted 1713
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_010221 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00093474 predicted 1026
2 SASI_Mm01_00093475 predicted 1640
3 SASI_Mm01_00093476 predicted 293
4 SASI_Mm01_00093477 predicted 1584
5 SASI_Mm01_00093478 predicted 610
6 SASI_Mm01_00093479 predicted 2051
7 SASI_Mm01_00093480 predicted 980
8 SASI_Mm01_00093481 predicted 676
9 SASI_Mm01_00093482 predicted 586
10 SASI_Mm02_00318069 predicted 1957
11 SASI_Mm01_00093473 predicted 405
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_010221
VALIDATED
FKBP10 MISSION shRNA Bacterial Glycerol Stock
FK506 binding protein 10, 65 kDa
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000111875    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_010221.1-2208s1c1
Sequence:CCGGGCCCTTTATTTGTACTGTCCTCTCGAGAGGACAGTACAAATAAAGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000111876    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_010221.1-963s1c1
Sequence:CCGGCCACTACAATGGCTCTTTGATCTCGAGATCAAAGAGCCATTGTAGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000111879    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_010221.1-1609s1c1
Sequence:CCGGGAAGACATGGATCTCAATAAACTCGAGTTTATTGAGATCCATGTCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000111878    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010221.1-1384s1c1
Sequence:CCGGGCCAACAAAGTGATCGAAGGTCTCGAGACCTTCGATCACTTTGTTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000111877    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010221.1-1672s1c1
Sequence:CCGGGCTCAAGTGAATGAAGGCAAACTCGAGTTTGCCTTCATTCACTTGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000339486    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.8 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_010221.2-2194s21c1
Sequence:CCGGTTCCCAGACGTGCCCTTTATTCTCGAGAATAAAGGGCACGTCTGGGAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000339487    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_010221.2-1010s21c1
Sequence:CCGGCCCGAAACCACACCTACAATACTCGAGTATTGTAGGTGTGGTTTCGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000339485    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010221.2-492s21c1
Sequence:CCGGCCCTGATGCCACCCTCTATTTCTCGAGAAATAGAGGGTGGCATCAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000339554    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_010221.2-960s21c1
Sequence:CCGGCCACTACAATGGCTCTTTGATCTCGAGATCAAAGAGCCATTGTAGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000339484    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_010221.2-1606s21c1
Sequence:CCGGGAAGACATGGATCTCAATAAACTCGAGTTTATTGAGATCCATGTCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_010221
VALIDATED
FKBP10 MISSION shRNA shRNA Plasmid DNA
FK506 binding protein 10, 65 kDa
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000111875    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_010221.1-2208s1c1
Sequence:CCGGGCCCTTTATTTGTACTGTCCTCTCGAGAGGACAGTACAAATAAAGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000111876    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_010221.1-963s1c1
Sequence:CCGGCCACTACAATGGCTCTTTGATCTCGAGATCAAAGAGCCATTGTAGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000111879    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_010221.1-1609s1c1
Sequence:CCGGGAAGACATGGATCTCAATAAACTCGAGTTTATTGAGATCCATGTCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000111878    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010221.1-1384s1c1
Sequence:CCGGGCCAACAAAGTGATCGAAGGTCTCGAGACCTTCGATCACTTTGTTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000111877    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010221.1-1672s1c1
Sequence:CCGGGCTCAAGTGAATGAAGGCAAACTCGAGTTTGCCTTCATTCACTTGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000339486    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.8 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_010221.2-2194s21c1
Sequence:CCGGTTCCCAGACGTGCCCTTTATTCTCGAGAATAAAGGGCACGTCTGGGAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000339487    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_010221.2-1010s21c1
Sequence:CCGGCCCGAAACCACACCTACAATACTCGAGTATTGTAGGTGTGGTTTCGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000339485    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010221.2-492s21c1
Sequence:CCGGCCCTGATGCCACCCTCTATTTCTCGAGAAATAGAGGGTGGCATCAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000339554    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_010221.2-960s21c1
Sequence:CCGGCCACTACAATGGCTCTTTGATCTCGAGATCAAAGAGCCATTGTAGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000339484    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_010221.2-1606s21c1
Sequence:CCGGGAAGACATGGATCTCAATAAACTCGAGTTTATTGAGATCCATGTCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_010221
VALIDATED
FKBP10 MISSION shRNA Lentiviral Transduction Particles
FK506 binding protein 10, 65 kDa
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000111875    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_010221.1-2208s1c1
Sequence:CCGGGCCCTTTATTTGTACTGTCCTCTCGAGAGGACAGTACAAATAAAGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000111876    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_010221.1-963s1c1
Sequence:CCGGCCACTACAATGGCTCTTTGATCTCGAGATCAAAGAGCCATTGTAGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000111879    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_010221.1-1609s1c1
Sequence:CCGGGAAGACATGGATCTCAATAAACTCGAGTTTATTGAGATCCATGTCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000111878    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010221.1-1384s1c1
Sequence:CCGGGCCAACAAAGTGATCGAAGGTCTCGAGACCTTCGATCACTTTGTTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000111877    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010221.1-1672s1c1
Sequence:CCGGGCTCAAGTGAATGAAGGCAAACTCGAGTTTGCCTTCATTCACTTGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000339486    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.8 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_010221.2-2194s21c1
Sequence:CCGGTTCCCAGACGTGCCCTTTATTCTCGAGAATAAAGGGCACGTCTGGGAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000339487    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_010221.2-1010s21c1
Sequence:CCGGCCCGAAACCACACCTACAATACTCGAGTATTGTAGGTGTGGTTTCGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000339485    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010221.2-492s21c1
Sequence:CCGGCCCTGATGCCACCCTCTATTTCTCGAGAAATAGAGGGTGGCATCAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000339554    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_010221.2-960s21c1
Sequence:CCGGCCACTACAATGGCTCTTTGATCTCGAGATCAAAGAGCCATTGTAGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000339484    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_010221.2-1606s21c1
Sequence:CCGGGAAGACATGGATCTCAATAAACTCGAGTTTATTGAGATCCATGTCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_021939
VALIDATED
FKBP10 MISSION shRNA Bacterial Glycerol Stock
FK506 binding protein 10, 65 kDa
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000053928    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.88 Cell Line: HeLa
TRC Version: 1 Clone ID:NM_021939.2-2040s1c1
Sequence:CCGGCCATCCCTAAACCACTTCCTTCTCGAGAAGGAAGTGGTTTAGGGATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000053932    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: HeLa
TRC Version: 1 Clone ID:NM_021939.2-284s1c1
Sequence:CCGGCTACCACTACAACGGCACTTTCTCGAGAAAGTGCCGTTGTAGTGGTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000053929    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: HeLa
TRC Version: 1 Clone ID:NM_021939.2-1016s1c1
Sequence:CCGGCCACACCTACAATACCTATATCTCGAGATATAGGTATTGTAGGTGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000053930    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: HeLa
TRC Version: 1 Clone ID:NM_021939.2-959s1c1
Sequence:CCGGCCACTACAATGGCTCCTTGATCTCGAGATCAAGGAGCCATTGTAGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000053931    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: HeLa
TRC Version: 1 Clone ID:NM_021939.2-767s1c1
Sequence:CCGGGAAGATTATCATCCCTCCATTCTCGAGAATGGAGGGATGATAATCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000370972    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: HeLa
TRC Version: 2 Clone ID:NM_021939.3-896s21c1
Sequence:CCGGTTCGACACCAGCTACAGTAAGCTCGAGCTTACTGTAGCTGGTGTCGAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000301045    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: HeLa
TRC Version: 2 Clone ID:NM_021939.3-1255s21c1
Sequence:CCGGCCACACCTACAATACCTATATCTCGAGATATAGGTATTGTAGGTGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000301127    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.81 Cell Line: HeLa
TRC Version: 2 Clone ID:NM_021939.3-2279s21c1
Sequence:CCGGCCATCCCTAAACCACTTCCTTCTCGAGAAGGAAGTGGTTTAGGGATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000331407    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: HeLa
TRC Version: 2 Clone ID:NM_021939.3-1198s21c1
Sequence:CCGGCCACTACAATGGCTCCTTGATCTCGAGATCAAGGAGCCATTGTAGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000370912    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: HeLa
TRC Version: 2 Clone ID:NM_021939.3-1522s21c1
Sequence:CCGGGGACTTTGTTCGATACCATTACTCGAGTAATGGTATCGAACAAAGTCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_021939
VALIDATED
FKBP10 MISSION shRNA shRNA Plasmid DNA
FK506 binding protein 10, 65 kDa
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000053928    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.88 Cell Line: HeLa
TRC Version: 1 Clone ID:NM_021939.2-2040s1c1
Sequence:CCGGCCATCCCTAAACCACTTCCTTCTCGAGAAGGAAGTGGTTTAGGGATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000053932    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: HeLa
TRC Version: 1 Clone ID:NM_021939.2-284s1c1
Sequence:CCGGCTACCACTACAACGGCACTTTCTCGAGAAAGTGCCGTTGTAGTGGTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000053929    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: HeLa
TRC Version: 1 Clone ID:NM_021939.2-1016s1c1
Sequence:CCGGCCACACCTACAATACCTATATCTCGAGATATAGGTATTGTAGGTGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000053930    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: HeLa
TRC Version: 1 Clone ID:NM_021939.2-959s1c1
Sequence:CCGGCCACTACAATGGCTCCTTGATCTCGAGATCAAGGAGCCATTGTAGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000053931    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: HeLa
TRC Version: 1 Clone ID:NM_021939.2-767s1c1
Sequence:CCGGGAAGATTATCATCCCTCCATTCTCGAGAATGGAGGGATGATAATCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000370972    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: HeLa
TRC Version: 2 Clone ID:NM_021939.3-896s21c1
Sequence:CCGGTTCGACACCAGCTACAGTAAGCTCGAGCTTACTGTAGCTGGTGTCGAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000301045    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: HeLa
TRC Version: 2 Clone ID:NM_021939.3-1255s21c1
Sequence:CCGGCCACACCTACAATACCTATATCTCGAGATATAGGTATTGTAGGTGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000301127    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.81 Cell Line: HeLa
TRC Version: 2 Clone ID:NM_021939.3-2279s21c1
Sequence:CCGGCCATCCCTAAACCACTTCCTTCTCGAGAAGGAAGTGGTTTAGGGATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000331407    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: HeLa
TRC Version: 2 Clone ID:NM_021939.3-1198s21c1
Sequence:CCGGCCACTACAATGGCTCCTTGATCTCGAGATCAAGGAGCCATTGTAGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000370912    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: HeLa
TRC Version: 2 Clone ID:NM_021939.3-1522s21c1
Sequence:CCGGGGACTTTGTTCGATACCATTACTCGAGTAATGGTATCGAACAAAGTCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_021939
VALIDATED
FKBP10 MISSION shRNA Lentiviral Transduction Particles
FK506 binding protein 10, 65 kDa
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000053928    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.88 Cell Line: HeLa
TRC Version: 1 Clone ID:NM_021939.2-2040s1c1
Sequence:CCGGCCATCCCTAAACCACTTCCTTCTCGAGAAGGAAGTGGTTTAGGGATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000053932    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: HeLa
TRC Version: 1 Clone ID:NM_021939.2-284s1c1
Sequence:CCGGCTACCACTACAACGGCACTTTCTCGAGAAAGTGCCGTTGTAGTGGTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000053929    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: HeLa
TRC Version: 1 Clone ID:NM_021939.2-1016s1c1
Sequence:CCGGCCACACCTACAATACCTATATCTCGAGATATAGGTATTGTAGGTGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000053930    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: HeLa
TRC Version: 1 Clone ID:NM_021939.2-959s1c1
Sequence:CCGGCCACTACAATGGCTCCTTGATCTCGAGATCAAGGAGCCATTGTAGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000053931    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: HeLa
TRC Version: 1 Clone ID:NM_021939.2-767s1c1
Sequence:CCGGGAAGATTATCATCCCTCCATTCTCGAGAATGGAGGGATGATAATCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000370972    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: HeLa
TRC Version: 2 Clone ID:NM_021939.3-896s21c1
Sequence:CCGGTTCGACACCAGCTACAGTAAGCTCGAGCTTACTGTAGCTGGTGTCGAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000301045    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: HeLa
TRC Version: 2 Clone ID:NM_021939.3-1255s21c1
Sequence:CCGGCCACACCTACAATACCTATATCTCGAGATATAGGTATTGTAGGTGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000301127    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.81 Cell Line: HeLa
TRC Version: 2 Clone ID:NM_021939.3-2279s21c1
Sequence:CCGGCCATCCCTAAACCACTTCCTTCTCGAGAAGGAAGTGGTTTAGGGATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000331407    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: HeLa
TRC Version: 2 Clone ID:NM_021939.3-1198s21c1
Sequence:CCGGCCACTACAATGGCTCCTTGATCTCGAGATCAAGGAGCCATTGTAGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000370912    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: HeLa
TRC Version: 2 Clone ID:NM_021939.3-1522s21c1
Sequence:CCGGGGACTTTGTTCGATACCATTACTCGAGTAATGGTATCGAACAAAGTCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks