EMAIL THIS PAGE TO A FRIEND

FKBP15

FK506 binding protein 15, 133kDa

101 Gene Product Result for
Synonyms: FKBP133 KIAA0674 PPP1R76
UniProtKB ID: Q5T1M5, Q05DK8, Q5T1M2, Q6DD85, Q9Y4D0
Gene ID:
Mouse(338355) FK506 binding protein 15
Rat(362528) FK506 binding protein 15
naked mole-rat(101710082) FK506 binding protein 15, 133kDa
domestic guinea pig(100721962) FK506 binding protein 15, 133kDa
sheep(101108805) FK506 binding protein 15, 133kDa
Domestic Rabbit(100349460) FK506 binding protein 15, 133kDa
chicken(417267) FK506 binding protein 15, 133kDa
cow(783009) FK506 binding protein 15, 133kDa
Horse(100053357) FK506 binding protein 15, 133kDa
domestic cat(101095290) FK506 binding protein 15, 133kDa
dog(481677) FK506 binding protein 15, 133kDa
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
HPA007979 Anti-FKBP15 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution human
immunohistochemistry, western blot pricing
SAB3500037 Anti-FKBP15 antibody produced in rabbit affinity isolated antibody, buffered aqueous solution mouse, rat, human
ELISA, immunofluorescence, immunohistochemistry, western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001045528 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_001045528 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_001045528 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-XM_376903 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-XM_376903 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-XM_376903 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_015258 Rosetta Predictions human pricing
XM_376903 Rosetta Predictions human pricing
XM_001057312 Rosetta Predictions rat pricing
XM_342846 Rosetta Predictions rat pricing
XM_485391 Rosetta Predictions mouse pricing
XM_982256 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_015258 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00347398 predicted 433
2 SASI_Hs02_00347399 predicted 568
3 SASI_Hs02_00347400 predicted 844
4 SASI_Hs02_00347401 predicted 1805
5 SASI_Hs02_00347402 predicted 720
6 SASI_Hs02_00347403 predicted 523
7 SASI_Hs02_00347404 predicted 2359
8 SASI_Hs02_00347405 predicted 1711
9 SASI_Hs02_00347406 predicted 1190
10 SASI_Hs02_00347407 predicted 1889
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_376903 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00267169 predicted 677
2 SASI_Hs01_00267170 predicted 805
3 SASI_Hs01_00267171 predicted 2138
4 SASI_Hs01_00267172 predicted 2051
5 SASI_Hs01_00267173 predicted 958
6 SASI_Hs01_00267174 predicted 2158
7 SASI_Hs01_00267175 predicted 2596
8 SASI_Hs01_00267176 predicted 1435
9 SASI_Hs01_00267177 predicted 2129
10 SASI_Hs01_00267178 predicted 2784
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001057312 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00285973 predicted 463
2 SASI_Rn02_00285974 predicted 1825
3 SASI_Rn02_00285975 predicted 407
4 SASI_Rn02_00285976 predicted 1518
5 SASI_Rn02_00285977 predicted 1068
6 SASI_Rn02_00285978 predicted 3331
7 SASI_Rn02_00285979 predicted 1505
8 SASI_Rn02_00285980 predicted 1774
9 SASI_Rn02_00285981 predicted 624
10 SASI_Rn02_00285982 predicted 2723
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_342846 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00394871 predicted 464
2 SASI_Rn02_00394872 predicted 1825
3 SASI_Rn02_00394873 predicted 402
4 SASI_Rn02_00394874 predicted 1521
5 SASI_Rn02_00394875 predicted 1066
6 SASI_Rn02_00394876 predicted 3329
7 SASI_Rn02_00394877 predicted 1504
8 SASI_Rn02_00394878 predicted 1773
9 SASI_Rn02_00394879 predicted 615
10 SASI_Rn02_00394880 predicted 2721
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_485391 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00208018 predicted 766
2 SASI_Mm02_00426655 predicted 1864
3 SASI_Mm01_00208020 predicted 899
4 SASI_Mm01_00208022 predicted 1074
5 SASI_Mm01_00208023 predicted 4016
6 SASI_Mm02_00426656 predicted 2516
7 SASI_Mm02_00426657 predicted 1369
8 SASI_Mm02_00426658 predicted 3428
9 SASI_Mm02_00426659 predicted 1632
10 SASI_Mm02_00426660 predicted 1879
11 SASI_Mm01_00208019 predicted 741
12 SASI_Mm01_00208021 predicted 241
13 SASI_Mm01_00208024 predicted 1851
14 SASI_Mm01_00208025 predicted 226
15 SASI_Mm01_00208026 predicted 601
16 SASI_Mm01_00208027 predicted 2102
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_982256 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00447758 predicted 692
2 SASI_Mm02_00447759 predicted 2040
3 SASI_Mm02_00447760 predicted 632
4 SASI_Mm02_00447761 predicted 1001
5 SASI_Mm02_00447762 predicted 3935
6 SASI_Mm02_00447763 predicted 2139
7 SASI_Mm02_00447764 predicted 1288
8 SASI_Mm02_00447765 predicted 491
9 SASI_Mm02_00447766 predicted 1996
10 SASI_Mm02_00447767 predicted 328
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001045528
FKBP15 MISSION shRNA Bacterial Glycerol Stock
FK506 binding protein 15, 133kDa
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000346992    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001045528.1-3890s21c1
Sequence:CCGGTGGTTCAGGGCTCTGAGTTAGCTCGAGCTAACTCAGAGCCCTGAACCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000346921    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001045528.1-372s21c1
Sequence:CCGGCCGCTACATAAATGGTCAATACTCGAGTATTGACCATTTATGTAGCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000346923    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001045528.1-516s21c1
Sequence:CCGGGCTAATGGTTCGGCCCAATAACTCGAGTTATTGGGCCGAACCATTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000346924    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001045528.1-870s21c1
Sequence:CCGGGAAAGGAGGAAAGCGCTTAATCTCGAGATTAAGCGCTTTCCTCCTTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000346922    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001045528.1-1357s21c1
Sequence:CCGGCAGCCAGCTCATCCGGTATTACTCGAGTAATACCGGATGAGCTGGCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001045528
FKBP15 MISSION shRNA shRNA Plasmid DNA
FK506 binding protein 15, 133kDa
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000346992    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001045528.1-3890s21c1
Sequence:CCGGTGGTTCAGGGCTCTGAGTTAGCTCGAGCTAACTCAGAGCCCTGAACCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000346921    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001045528.1-372s21c1
Sequence:CCGGCCGCTACATAAATGGTCAATACTCGAGTATTGACCATTTATGTAGCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000346923    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001045528.1-516s21c1
Sequence:CCGGGCTAATGGTTCGGCCCAATAACTCGAGTTATTGGGCCGAACCATTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000346924    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001045528.1-870s21c1
Sequence:CCGGGAAAGGAGGAAAGCGCTTAATCTCGAGATTAAGCGCTTTCCTCCTTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000346922    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001045528.1-1357s21c1
Sequence:CCGGCAGCCAGCTCATCCGGTATTACTCGAGTAATACCGGATGAGCTGGCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001045528
FKBP15 MISSION shRNA Lentiviral Transduction Particles
FK506 binding protein 15, 133kDa
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000346992    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001045528.1-3890s21c1
Sequence:CCGGTGGTTCAGGGCTCTGAGTTAGCTCGAGCTAACTCAGAGCCCTGAACCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000346921    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001045528.1-372s21c1
Sequence:CCGGCCGCTACATAAATGGTCAATACTCGAGTATTGACCATTTATGTAGCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000346923    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001045528.1-516s21c1
Sequence:CCGGGCTAATGGTTCGGCCCAATAACTCGAGTTATTGGGCCGAACCATTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000346924    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001045528.1-870s21c1
Sequence:CCGGGAAAGGAGGAAAGCGCTTAATCTCGAGATTAAGCGCTTTCCTCCTTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000346922    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001045528.1-1357s21c1
Sequence:CCGGCAGCCAGCTCATCCGGTATTACTCGAGTAATACCGGATGAGCTGGCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-XM_376903
VALIDATED
FKBP15 MISSION shRNA Bacterial Glycerol Stock
FK506 binding protein 15, 133kDa
Human
4 Products Total
TRC Number Price Set Price (4)? Select
TRCN0000204015    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: A549
TRC Version: 1.5 Clone ID:XM_376903.1-2800s1c1
Sequence:CCGGGAACAGCACATCAAGGAACTACTCGAGTAGTTCCTTGATGTGCTGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000188951    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_376903.1-1109s1c1
Sequence:CCGGGCTCTGATGGTCACAGTGTTACTCGAGTAACACTGTGACCATCAGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000186832    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 1.5 Clone ID:XM_376903.1-592s1c1
Sequence:CCGGGCTAGGATTCATGTGAACTTTCTCGAGAAAGTTCACATGAATCCTAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000188485    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_376903.1-1757s1c1
Sequence:CCGGCCCGGCAACATAACACTGAAACTCGAGTTTCAGTGTTATGTTGCCGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-XM_376903
VALIDATED
FKBP15 MISSION shRNA shRNA Plasmid DNA
FK506 binding protein 15, 133kDa
Human
4 Products Total
TRC Number Vector Price Set Price (4)? Select
TRCN0000204015    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: A549
TRC Version: 1.5 Clone ID:XM_376903.1-2800s1c1
Sequence:CCGGGAACAGCACATCAAGGAACTACTCGAGTAGTTCCTTGATGTGCTGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000188951    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_376903.1-1109s1c1
Sequence:CCGGGCTCTGATGGTCACAGTGTTACTCGAGTAACACTGTGACCATCAGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000186832    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 1.5 Clone ID:XM_376903.1-592s1c1
Sequence:CCGGGCTAGGATTCATGTGAACTTTCTCGAGAAAGTTCACATGAATCCTAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000188485    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_376903.1-1757s1c1
Sequence:CCGGCCCGGCAACATAACACTGAAACTCGAGTTTCAGTGTTATGTTGCCGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-XM_376903
VALIDATED
FKBP15 MISSION shRNA Lentiviral Transduction Particles
FK506 binding protein 15, 133kDa
Human
4 Products Total
TRC Number Volume Titer Vector Price Set Price (4)? Select
TRCN0000204015    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: A549
TRC Version: 1.5 Clone ID:XM_376903.1-2800s1c1
Sequence:CCGGGAACAGCACATCAAGGAACTACTCGAGTAGTTCCTTGATGTGCTGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000188951    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_376903.1-1109s1c1
Sequence:CCGGGCTCTGATGGTCACAGTGTTACTCGAGTAACACTGTGACCATCAGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000186832    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 1.5 Clone ID:XM_376903.1-592s1c1
Sequence:CCGGGCTAGGATTCATGTGAACTTTCTCGAGAAAGTTCACATGAATCCTAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000188485    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_376903.1-1757s1c1
Sequence:CCGGCCCGGCAACATAACACTGAAACTCGAGTTTCAGTGTTATGTTGCCGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks