EMAIL THIS PAGE TO A FRIEND

FKBP1A

FK506 binding protein 1A, 12kDa

85 Gene Product Result for
Synonyms: FKBP-12 FKBP-1A FKBP1 FKBP12 PKC12 PKCI2 PPIASE
Gene ID:
Human(2280) Summary: The protein encoded by this gene is a member of the immunophilin protein family, which play a role in immunoregulation and basic cellular processes involving protein folding and trafficking. The protein is a cis-trans prolyl isomerase that binds the immunosuppressants FK506 and rapamycin. It interacts with several intracellular signal transduction proteins including type I TGF-beta receptor. It also interacts with multiple intracellular calcium release channels, and coordinates multi-protein complex formation of the tetrameric skeletal muscle ryanodine receptor. In mouse, deletion of this homologous gene causes congenital heart disorder known as noncompaction of left ventricular myocardium. Multiple alternatively spliced variants, encoding the same protein, have been identified. The human genome contains five pseudogenes related to this gene, at least one of which is transcribed. [provided by RefSeq, Sep 2008]
Mouse(14225) FK506 binding protein 1a
Rat(25639) FK506 binding protein 1a
chicken(374233) FK506 binding protein 1A, 12kDa
domestic cat(101100379) FK506 binding protein 1A, 12kDa
cow(614795) FK506 binding protein 1A, 12kDa
dog(100686033) FK506 binding protein 1A, 12kDa
sheep(101105938) FK506 binding protein 1A, 12kDa
Domestic Rabbit(100328942) FK506 binding protein 1A, 12kDa
domestic guinea pig(100713967) FK506 binding protein 1A, 12kDa
naked mole-rat(101702830) FK506 binding protein 1A, 12kDa
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_008019 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_008019 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_008019 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_054014 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_054014 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_054014 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_000801 Rosetta Predictions human pricing
NM_054014 Rosetta Predictions human pricing
NM_013102 Rosetta Predictions rat pricing
NM_008019 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_000801 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00303248 predicted 563
2 SASI_Hs02_00303249 predicted 229
3 SASI_Hs02_00303250 predicted 472
4 SASI_Hs02_00303251 predicted 531
5 SASI_Hs02_00303252 predicted 445
6 SASI_Hs02_00303253 predicted 230
7 SASI_Hs02_00303254 predicted 572
8 SASI_Hs02_00303255 predicted 528
9 SASI_Hs01_00145368 predicted 547
10 SASI_Hs02_00303256 predicted 525
11 SASI_Hs01_00145369 predicted 498
12 SASI_Hs01_00145370 predicted 767
13 SASI_Hs01_00145371 predicted 630
14 SASI_Hs01_00145372 predicted 627
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_054014 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00049055 predicted 580
2 SASI_Hs01_00049056 predicted 454
3 SASI_Hs02_00361930 predicted 233
4 SASI_Hs01_00049057 predicted 517
5 SASI_Hs01_00049058 predicted 509
6 SASI_Hs02_00361931 predicted 222
7 SASI_Hs01_00049060 predicted 460
8 SASI_Hs02_00361932 predicted 436
9 SASI_Hs02_00361933 predicted 374
10 SASI_Hs02_00361934 predicted 394
11 SASI_Hs01_00049059 predicted 497
12 SASI_Hs01_00049061 predicted 497
13 SASI_Hs01_00049062 predicted 745
14 SASI_Hs01_00049063 predicted 687
15 SASI_Hs01_00049064 predicted 595
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_013102 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00089167 predicted 399
2 SASI_Rn01_00089168 predicted 529
3 SASI_Rn01_00089169 predicted 463
4 SASI_Rn01_00089171 predicted 523
5 SASI_Rn01_00089170 predicted 334
6 SASI_Rn01_00089172 predicted 503
7 SASI_Rn01_00089173 predicted 667
8 SASI_Rn01_00089174 predicted 681
9 SASI_Rn01_00089175 predicted 660
10 SASI_Rn01_00089176 predicted 685
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_008019 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00180792 predicted 485
2 SASI_Mm02_00312958 predicted 543
3 SASI_Mm02_00312959 predicted 479
4 SASI_Mm01_00180789 predicted 653
5 SASI_Mm01_00180790 predicted 663
6 SASI_Mm01_00180796 predicted 834
7 SASI_Mm02_00312960 predicted 818
8 SASI_Mm02_00312961 predicted 819
9 SASI_Mm02_00312962 predicted 817
10 SASI_Mm02_00312963 predicted 829
11 SASI_Mm01_00180788 predicted 441
12 SASI_Mm01_00180791 predicted 470
13 SASI_Mm01_00180793 predicted 596
14 SASI_Mm01_00180794 predicted 726
15 SASI_Mm01_00180795 predicted 802
16 SASI_Mm01_00180797 predicted 745
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_008019
VALIDATED
FKBP1A MISSION shRNA Bacterial Glycerol Stock
FK506 binding protein 1A, 12kDa
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000012488    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_008019.1-931s1c1
Sequence:CCGGCCTGTTAAACTGAAAGCCCTACTCGAGTAGGGCTTTCAGTTTAACAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000012492    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008019.1-208s1c1
Sequence:CCGGTGATTCCTCTCGGGACAGAAACTCGAGTTTCTGTCCCGAGAGGAATCATTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000012491    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008019.1-314s1c1
Sequence:CCGGGCCAAACTGATAATCTCCTCACTCGAGTGAGGAGATTATCAGTTTGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000012489    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008019.1-362s1c1
Sequence:CCGGCCAGGCATCATCCCACCACATCTCGAGATGTGGTGGGATGATGCCTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000012490    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008019.1-186s1c1
Sequence:CCGGTGCTTGAAGATGGAAAGAAATCTCGAGATTTCTTTCCATCTTCAAGCATTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000428332    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_008019.2-743s21c1
Sequence:CCGGACCTAAACTATATGCCATAAACTCGAGTTTATGGCATATAGTTTAGGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000419027    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008019.2-356s21c1
Sequence:CCGGTACACTAGGCAAGCAGGAGGTCTCGAGACCTCCTGCTTGCCTAGTGTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000416982    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_008019.2-846s21c1
Sequence:CCGGACAGCACAAGCGATGGGTTAACTCGAGTTAACCCATCGCTTGTGCTGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000418228    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008019.2-348s21c1
Sequence:CCGGTTTAAGTTTACACTAGGCAAGCTCGAGCTTGCCTAGTGTAAACTTAAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_008019
VALIDATED
FKBP1A MISSION shRNA shRNA Plasmid DNA
FK506 binding protein 1A, 12kDa
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000012488    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_008019.1-931s1c1
Sequence:CCGGCCTGTTAAACTGAAAGCCCTACTCGAGTAGGGCTTTCAGTTTAACAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000012492    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008019.1-208s1c1
Sequence:CCGGTGATTCCTCTCGGGACAGAAACTCGAGTTTCTGTCCCGAGAGGAATCATTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000012491    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008019.1-314s1c1
Sequence:CCGGGCCAAACTGATAATCTCCTCACTCGAGTGAGGAGATTATCAGTTTGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000012489    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008019.1-362s1c1
Sequence:CCGGCCAGGCATCATCCCACCACATCTCGAGATGTGGTGGGATGATGCCTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000012490    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008019.1-186s1c1
Sequence:CCGGTGCTTGAAGATGGAAAGAAATCTCGAGATTTCTTTCCATCTTCAAGCATTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000428332    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_008019.2-743s21c1
Sequence:CCGGACCTAAACTATATGCCATAAACTCGAGTTTATGGCATATAGTTTAGGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000419027    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008019.2-356s21c1
Sequence:CCGGTACACTAGGCAAGCAGGAGGTCTCGAGACCTCCTGCTTGCCTAGTGTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000416982    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_008019.2-846s21c1
Sequence:CCGGACAGCACAAGCGATGGGTTAACTCGAGTTAACCCATCGCTTGTGCTGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000418228    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008019.2-348s21c1
Sequence:CCGGTTTAAGTTTACACTAGGCAAGCTCGAGCTTGCCTAGTGTAAACTTAAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_008019
VALIDATED
FKBP1A MISSION shRNA Lentiviral Transduction Particles
FK506 binding protein 1A, 12kDa
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000012488    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_008019.1-931s1c1
Sequence:CCGGCCTGTTAAACTGAAAGCCCTACTCGAGTAGGGCTTTCAGTTTAACAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000012492    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008019.1-208s1c1
Sequence:CCGGTGATTCCTCTCGGGACAGAAACTCGAGTTTCTGTCCCGAGAGGAATCATTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000012491    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008019.1-314s1c1
Sequence:CCGGGCCAAACTGATAATCTCCTCACTCGAGTGAGGAGATTATCAGTTTGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000012489    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008019.1-362s1c1
Sequence:CCGGCCAGGCATCATCCCACCACATCTCGAGATGTGGTGGGATGATGCCTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000012490    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008019.1-186s1c1
Sequence:CCGGTGCTTGAAGATGGAAAGAAATCTCGAGATTTCTTTCCATCTTCAAGCATTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000428332    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_008019.2-743s21c1
Sequence:CCGGACCTAAACTATATGCCATAAACTCGAGTTTATGGCATATAGTTTAGGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000419027    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008019.2-356s21c1
Sequence:CCGGTACACTAGGCAAGCAGGAGGTCTCGAGACCTCCTGCTTGCCTAGTGTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000416982    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_008019.2-846s21c1
Sequence:CCGGACAGCACAAGCGATGGGTTAACTCGAGTTAACCCATCGCTTGTGCTGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000418228    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008019.2-348s21c1
Sequence:CCGGTTTAAGTTTACACTAGGCAAGCTCGAGCTTGCCTAGTGTAAACTTAAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_054014
VALIDATED
FKBP1A MISSION shRNA Bacterial Glycerol Stock
FK506 binding protein 1A, 12kDa
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000005949    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 1 Clone ID:NM_054014.1-315s1c1
Sequence:CCGGAGAGAGCCAAACTGACTATATCTCGAGATATAGTCAGTTTGGCTCTCTTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000005953    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: A549
TRC Version: 1 Clone ID:NM_054014.1-316s1c1
Sequence:CCGGGAGAGCCAAACTGACTATATCCTCGAGGATATAGTCAGTTTGGCTCTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000005950    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: A549
TRC Version: 1 Clone ID:NM_054014.1-341s1c1
Sequence:CCGGGATTATGCCTATGGTGCCACTCTCGAGAGTGGCACCATAGGCATAATCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000005952    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_054014.1-339s1c1
Sequence:CCGGCAGATTATGCCTATGGTGCCACTCGAGTGGCACCATAGGCATAATCTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000005951    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 1 Clone ID:NM_054014.1-320s1c1
Sequence:CCGGGCCAAACTGACTATATCTCCACTCGAGTGGAGATATAGTCAGTTTGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000272520    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 2 Clone ID:NM_054014.2-471s21c1
Sequence:CCGGCTTCGATGTGGAGCTTCTAAACTCGAGTTTAGAAGCTCCACATCGAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000272519    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 2 Clone ID:NM_054014.2-297s21c1
Sequence:CCGGGGACAGAAACAAGCCCTTTAACTCGAGTTAAAGGGCTTGTTTCTGTCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000272518    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_054014.2-572s21c1
Sequence:CCGGCCTTTGCTCCTCCCATGTTATCTCGAGATAACATGGGAGGAGCAAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000272583    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 2 Clone ID:NM_054014.2-252s21c1
Sequence:CCGGCTACACCGGGATGCTTGAAGACTCGAGTCTTCAAGCATCCCGGTGTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000284784    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 2 Clone ID:NM_054014.2-386s21c1
Sequence:CCGGAGAGAGCCAAACTGACTATATCTCGAGATATAGTCAGTTTGGCTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_054014
VALIDATED
FKBP1A MISSION shRNA shRNA Plasmid DNA
FK506 binding protein 1A, 12kDa
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000005949    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 1 Clone ID:NM_054014.1-315s1c1
Sequence:CCGGAGAGAGCCAAACTGACTATATCTCGAGATATAGTCAGTTTGGCTCTCTTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000005953    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: A549
TRC Version: 1 Clone ID:NM_054014.1-316s1c1
Sequence:CCGGGAGAGCCAAACTGACTATATCCTCGAGGATATAGTCAGTTTGGCTCTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000005950    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: A549
TRC Version: 1 Clone ID:NM_054014.1-341s1c1
Sequence:CCGGGATTATGCCTATGGTGCCACTCTCGAGAGTGGCACCATAGGCATAATCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000005952    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_054014.1-339s1c1
Sequence:CCGGCAGATTATGCCTATGGTGCCACTCGAGTGGCACCATAGGCATAATCTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000005951    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 1 Clone ID:NM_054014.1-320s1c1
Sequence:CCGGGCCAAACTGACTATATCTCCACTCGAGTGGAGATATAGTCAGTTTGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000272520    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 2 Clone ID:NM_054014.2-471s21c1
Sequence:CCGGCTTCGATGTGGAGCTTCTAAACTCGAGTTTAGAAGCTCCACATCGAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000272519    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 2 Clone ID:NM_054014.2-297s21c1
Sequence:CCGGGGACAGAAACAAGCCCTTTAACTCGAGTTAAAGGGCTTGTTTCTGTCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000272518    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_054014.2-572s21c1
Sequence:CCGGCCTTTGCTCCTCCCATGTTATCTCGAGATAACATGGGAGGAGCAAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000272583    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 2 Clone ID:NM_054014.2-252s21c1
Sequence:CCGGCTACACCGGGATGCTTGAAGACTCGAGTCTTCAAGCATCCCGGTGTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000284784    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 2 Clone ID:NM_054014.2-386s21c1
Sequence:CCGGAGAGAGCCAAACTGACTATATCTCGAGATATAGTCAGTTTGGCTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_054014
VALIDATED
FKBP1A MISSION shRNA Lentiviral Transduction Particles
FK506 binding protein 1A, 12kDa
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000005949    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 1 Clone ID:NM_054014.1-315s1c1
Sequence:CCGGAGAGAGCCAAACTGACTATATCTCGAGATATAGTCAGTTTGGCTCTCTTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000005953    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: A549
TRC Version: 1 Clone ID:NM_054014.1-316s1c1
Sequence:CCGGGAGAGCCAAACTGACTATATCCTCGAGGATATAGTCAGTTTGGCTCTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000005950    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: A549
TRC Version: 1 Clone ID:NM_054014.1-341s1c1
Sequence:CCGGGATTATGCCTATGGTGCCACTCTCGAGAGTGGCACCATAGGCATAATCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000005952    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_054014.1-339s1c1
Sequence:CCGGCAGATTATGCCTATGGTGCCACTCGAGTGGCACCATAGGCATAATCTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000005951    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 1 Clone ID:NM_054014.1-320s1c1
Sequence:CCGGGCCAAACTGACTATATCTCCACTCGAGTGGAGATATAGTCAGTTTGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000272520    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 2 Clone ID:NM_054014.2-471s21c1
Sequence:CCGGCTTCGATGTGGAGCTTCTAAACTCGAGTTTAGAAGCTCCACATCGAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000272519    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 2 Clone ID:NM_054014.2-297s21c1
Sequence:CCGGGGACAGAAACAAGCCCTTTAACTCGAGTTAAAGGGCTTGTTTCTGTCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000272518    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_054014.2-572s21c1
Sequence:CCGGCCTTTGCTCCTCCCATGTTATCTCGAGATAACATGGGAGGAGCAAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000272583    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 2 Clone ID:NM_054014.2-252s21c1
Sequence:CCGGCTACACCGGGATGCTTGAAGACTCGAGTCTTCAAGCATCCCGGTGTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000284784    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 2 Clone ID:NM_054014.2-386s21c1
Sequence:CCGGAGAGAGCCAAACTGACTATATCTCGAGATATAGTCAGTTTGGCTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks