EMAIL THIS PAGE TO A FRIEND

FKBP1B

FK506 binding protein 1B, 12.6 kDa

146 Gene Product Result for
Synonyms: FKBP12.6 FKBP1L OTK4 PKBP1L PPIase
UniProtKB ID: P68106, Q13664, Q16645, Q53TM2, Q9BQ40
Gene ID:
Human(2281) Summary: The protein encoded by this gene is a member of the immunophilin protein family, which play a role in immunoregulation and basic cellular processes involving protein folding and trafficking. This encoded protein is a cis-trans prolyl isomerase that binds the immunosuppressants FK506 and rapamycin. It is highly similar to the FK506-binding protein 1A. Its physiological role is thought to be in excitation-contraction coupling in cardiac muscle. There are two alternatively spliced transcript variants of this gene encoding different isoforms. [provided by RefSeq, Jul 2008]
Mouse(14226) FK506 binding protein 1b
Rat(58950) FK506 binding protein 1B
Zebrafish(393785) FK506 binding protein 1b
chicken(395254) FK506 binding protein 1B, 12.6 kDa
dog(612965) FK506 binding protein 1B, 12.6 kDa
cow(785179) FK506 binding protein 1B, 12.6 kDa
domestic cat(101097388) FK506 binding protein 1B, 12.6 kDa
naked mole-rat(101710015) FK506 binding protein 1B, 12.6 kDa
domestic guinea pig(100713669) FK506 binding protein 1B, 12.6 kDa
sheep(101108378) FK506 binding protein 1B, 12.6 kDa
Domestic Rabbit(100008888) FK506 binding protein 1B, 12.6 kDa
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Proteins

Product # Description Species Add to Cart
 
SRP6092 FKBP1B human recombinant, expressed in E. coli, ≥90% (SDS-PAGE) human pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_016863 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_016863 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_016863 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_004116 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_004116 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_004116 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_004116 Rosetta Predictions human pricing
NM_054033 Rosetta Predictions human pricing
NM_022675 Rosetta Predictions rat pricing
NM_016863 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_004116 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00198259 predicted 594
2 SASI_Hs01_00198260 predicted 595
3 SASI_Hs01_00198261 predicted 555
4 SASI_Hs01_00198262 predicted 585
5 SASI_Hs01_00198263 predicted 214
6 SASI_Hs01_00198265 predicted 675
7 SASI_Hs01_00198266 predicted 576
8 SASI_Hs01_00198267 predicted 211
9 SASI_Hs01_00198264 predicted 543
10 SASI_Hs01_00198268 predicted 625
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_054033 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00198686 predicted 637
2 SASI_Hs01_00198687 predicted 638
3 SASI_Hs01_00198688 predicted 602
4 SASI_Hs01_00198689 predicted 625
5 SASI_Hs01_00198690 predicted 214
6 SASI_Hs01_00198692 predicted 715
7 SASI_Hs01_00198693 predicted 612
8 SASI_Hs01_00198694 predicted 472
9 SASI_Hs01_00198695 predicted 210
10 SASI_Hs02_00361976 predicted 456
11 SASI_Hs01_00198691 predicted 593
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_022675 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00064160 predicted 57
2 SASI_Rn01_00064162 predicted 24
3 SASI_Rn01_00064163 predicted 134
4 SASI_Rn01_00064164 predicted 129
5 SASI_Rn01_00064165 predicted 99
6 SASI_Rn02_00263455 predicted 33
7 SASI_Rn01_00064166 predicted 79
8 SASI_Rn01_00064167 predicted 118
9 SASI_Rn01_00064168 predicted 27
10 SASI_Rn02_00263456 predicted 148
11 SASI_Rn01_00064159 predicted 126
12 SASI_Rn01_00064161 predicted 279
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_016863 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00070203 predicted 706
2 SASI_Mm02_00323654 predicted 276
3 SASI_Mm01_00070204 predicted 440
4 SASI_Mm01_00070205 predicted 262
5 SASI_Mm01_00070207 predicted 610
6 SASI_Mm01_00070208 predicted 737
7 SASI_Mm01_00070209 predicted 436
8 SASI_Mm01_00070210 predicted 670
9 SASI_Mm01_00070211 predicted 282
10 SASI_Mm01_00070212 predicted 217
11 SASI_Mm01_00070206 predicted 552
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_016863
VALIDATED
FKBP1B MISSION shRNA Bacterial Glycerol Stock
FK506 binding protein 1B, 12.6 kDa
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000349499    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_016863.3-926s21c1
Sequence:CCGGCCCTCTGGAAATAATATGTAACTCGAGTTACATATTATTTCCAGAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000312380    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016863.3-292s21c1
Sequence:CCGGCAAACCTTTCAAGTTCAGAATCTCGAGATTCTGAACTTGAAAGGTTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000312317    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016863.3-283s21c1
Sequence:CCGGAGACAGAAACAAACCTTTCAACTCGAGTTGAAAGGTTTGTTTCTGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000312379    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016863.3-196s21c1
Sequence:CCGGCGGAAGGACATTCCCTAAGAACTCGAGTTCTTAGGGAATGTCCTTCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000111815    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.92 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_016863.2-906s1c1
Sequence:CCGGCCCTCTGGAAATAATATGTAACTCGAGTTACATATTATTTCCAGAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000111818    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_016863.2-405s1c1
Sequence:CCGGCCCGGTGTCATCCCTCCCAATCTCGAGATTGGGAGGGATGACACCGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000111819    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_016863.2-272s1c1
Sequence:CCGGCAAACCTTTCAAGTTCAGAATCTCGAGATTCTGAACTTGAAAGGTTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000111816    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_016863.2-176s1c1
Sequence:CCGGCGGAAGGACATTCCCTAAGAACTCGAGTTCTTAGGGAATGTCCTTCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000111817    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016863.2-263s1c1
Sequence:CCGGAGACAGAAACAAACCTTTCAACTCGAGTTGAAAGGTTTGTTTCTGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_016863
VALIDATED
FKBP1B MISSION shRNA shRNA Plasmid DNA
FK506 binding protein 1B, 12.6 kDa
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000349499    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_016863.3-926s21c1
Sequence:CCGGCCCTCTGGAAATAATATGTAACTCGAGTTACATATTATTTCCAGAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000312380    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016863.3-292s21c1
Sequence:CCGGCAAACCTTTCAAGTTCAGAATCTCGAGATTCTGAACTTGAAAGGTTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000312317    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016863.3-283s21c1
Sequence:CCGGAGACAGAAACAAACCTTTCAACTCGAGTTGAAAGGTTTGTTTCTGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000312379    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016863.3-196s21c1
Sequence:CCGGCGGAAGGACATTCCCTAAGAACTCGAGTTCTTAGGGAATGTCCTTCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000111815    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.92 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_016863.2-906s1c1
Sequence:CCGGCCCTCTGGAAATAATATGTAACTCGAGTTACATATTATTTCCAGAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000111818    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_016863.2-405s1c1
Sequence:CCGGCCCGGTGTCATCCCTCCCAATCTCGAGATTGGGAGGGATGACACCGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000111819    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_016863.2-272s1c1
Sequence:CCGGCAAACCTTTCAAGTTCAGAATCTCGAGATTCTGAACTTGAAAGGTTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000111816    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_016863.2-176s1c1
Sequence:CCGGCGGAAGGACATTCCCTAAGAACTCGAGTTCTTAGGGAATGTCCTTCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000111817    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016863.2-263s1c1
Sequence:CCGGAGACAGAAACAAACCTTTCAACTCGAGTTGAAAGGTTTGTTTCTGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_016863
VALIDATED
FKBP1B MISSION shRNA Lentiviral Transduction Particles
FK506 binding protein 1B, 12.6 kDa
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000349499    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_016863.3-926s21c1
Sequence:CCGGCCCTCTGGAAATAATATGTAACTCGAGTTACATATTATTTCCAGAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000312380    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016863.3-292s21c1
Sequence:CCGGCAAACCTTTCAAGTTCAGAATCTCGAGATTCTGAACTTGAAAGGTTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000312317    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016863.3-283s21c1
Sequence:CCGGAGACAGAAACAAACCTTTCAACTCGAGTTGAAAGGTTTGTTTCTGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000312379    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016863.3-196s21c1
Sequence:CCGGCGGAAGGACATTCCCTAAGAACTCGAGTTCTTAGGGAATGTCCTTCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000111815    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.92 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_016863.2-906s1c1
Sequence:CCGGCCCTCTGGAAATAATATGTAACTCGAGTTACATATTATTTCCAGAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000111818    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_016863.2-405s1c1
Sequence:CCGGCCCGGTGTCATCCCTCCCAATCTCGAGATTGGGAGGGATGACACCGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000111819    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_016863.2-272s1c1
Sequence:CCGGCAAACCTTTCAAGTTCAGAATCTCGAGATTCTGAACTTGAAAGGTTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000111816    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_016863.2-176s1c1
Sequence:CCGGCGGAAGGACATTCCCTAAGAACTCGAGTTCTTAGGGAATGTCCTTCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000111817    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016863.2-263s1c1
Sequence:CCGGAGACAGAAACAAACCTTTCAACTCGAGTTGAAAGGTTTGTTTCTGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_004116
VALIDATED
FKBP1B MISSION shRNA Bacterial Glycerol Stock
FK506 binding protein 1B, 12.6 kDa
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000330625    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.89 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_004116.3-739s21c1
Sequence:CCGGAGATCTCTTGTTCGCACAATCCTCGAGGATTGTGCGAACAAGAGATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000330566    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_004116.3-241s21c1
Sequence:CCGGGAAGTTTGATTCATCCAGAGACTCGAGTCTCTGGATGAATCAAACTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000330624    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_004116.3-277s21c1
Sequence:CCGGCAAGTTCAGAATTGGCAAACACTCGAGTGTTTGCCAATTCTGAACTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000330567    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_004116.3-255s21c1
Sequence:CCGGCCAGAGACAGAAACAAACCTTCTCGAGAAGGTTTGTTTCTGTCTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000179854    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_004116.2-211s1c1
Sequence:CCGGCCAGAGACAGAAACAAACCTTCTCGAGAAGGTTTGTTTCTGTCTCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000153439    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_004116.2-228s1c1
Sequence:CCGGCCTTTCAAGTTCAGAATTGGCCTCGAGGCCAATTCTGAACTTGAAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000152328    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_004116.2-233s1c1
Sequence:CCGGCAAGTTCAGAATTGGCAAACACTCGAGTGTTTGCCAATTCTGAACTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000151663    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_004116.2-197s1c1
Sequence:CCGGGAAGTTTGATTCATCCAGAGACTCGAGTCTCTGGATGAATCAAACTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000151691    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_004116.2-212s1c1
Sequence:CCGGCAGAGACAGAAACAAACCTTTCTCGAGAAAGGTTTGTTTCTGTCTCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_004116
VALIDATED
FKBP1B MISSION shRNA shRNA Plasmid DNA
FK506 binding protein 1B, 12.6 kDa
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000330625    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.89 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_004116.3-739s21c1
Sequence:CCGGAGATCTCTTGTTCGCACAATCCTCGAGGATTGTGCGAACAAGAGATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000330566    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_004116.3-241s21c1
Sequence:CCGGGAAGTTTGATTCATCCAGAGACTCGAGTCTCTGGATGAATCAAACTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000330624    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_004116.3-277s21c1
Sequence:CCGGCAAGTTCAGAATTGGCAAACACTCGAGTGTTTGCCAATTCTGAACTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000330567    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_004116.3-255s21c1
Sequence:CCGGCCAGAGACAGAAACAAACCTTCTCGAGAAGGTTTGTTTCTGTCTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000179854    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_004116.2-211s1c1
Sequence:CCGGCCAGAGACAGAAACAAACCTTCTCGAGAAGGTTTGTTTCTGTCTCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000153439    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_004116.2-228s1c1
Sequence:CCGGCCTTTCAAGTTCAGAATTGGCCTCGAGGCCAATTCTGAACTTGAAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000152328    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_004116.2-233s1c1
Sequence:CCGGCAAGTTCAGAATTGGCAAACACTCGAGTGTTTGCCAATTCTGAACTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000151663    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_004116.2-197s1c1
Sequence:CCGGGAAGTTTGATTCATCCAGAGACTCGAGTCTCTGGATGAATCAAACTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000151691    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_004116.2-212s1c1
Sequence:CCGGCAGAGACAGAAACAAACCTTTCTCGAGAAAGGTTTGTTTCTGTCTCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_004116
VALIDATED
FKBP1B MISSION shRNA Lentiviral Transduction Particles
FK506 binding protein 1B, 12.6 kDa
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000330625    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.89 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_004116.3-739s21c1
Sequence:CCGGAGATCTCTTGTTCGCACAATCCTCGAGGATTGTGCGAACAAGAGATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000330566    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_004116.3-241s21c1
Sequence:CCGGGAAGTTTGATTCATCCAGAGACTCGAGTCTCTGGATGAATCAAACTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000330624    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_004116.3-277s21c1
Sequence:CCGGCAAGTTCAGAATTGGCAAACACTCGAGTGTTTGCCAATTCTGAACTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000330567    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_004116.3-255s21c1
Sequence:CCGGCCAGAGACAGAAACAAACCTTCTCGAGAAGGTTTGTTTCTGTCTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000179854    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_004116.2-211s1c1
Sequence:CCGGCCAGAGACAGAAACAAACCTTCTCGAGAAGGTTTGTTTCTGTCTCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000153439    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_004116.2-228s1c1
Sequence:CCGGCCTTTCAAGTTCAGAATTGGCCTCGAGGCCAATTCTGAACTTGAAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000152328    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_004116.2-233s1c1
Sequence:CCGGCAAGTTCAGAATTGGCAAACACTCGAGTGTTTGCCAATTCTGAACTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000151663    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_004116.2-197s1c1
Sequence:CCGGGAAGTTTGATTCATCCAGAGACTCGAGTCTCTGGATGAATCAAACTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000151691    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_004116.2-212s1c1
Sequence:CCGGCAGAGACAGAAACAAACCTTTCTCGAGAAAGGTTTGTTTCTGTCTCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks