EMAIL THIS PAGE TO A FRIEND

FKBP2

FK506 binding protein 2, 13kDa

88 Gene Product Result for
Synonyms: FKBP-13 PPIase
UniProtKB ID: P26885, Q5BJH9, Q9BTS7
Gene ID:
Human(2286) Summary: The protein encoded by this gene is a member of the immunophilin protein family, which play a role in immunoregulation and basic cellular processes involving protein folding and trafficking. This encoded protein is a cis-trans prolyl isomerase that binds the immunosuppressants FK506 and rapamycin. It is thought to function as an ER chaperone and may also act as a component of membrane cytoskeletal scaffolds. Multiple alternatively spliced variants, encoding the same protein, have been identified. [provided by RefSeq, Sep 2008]
Mouse(14227) FK506 binding protein 2
Rat(293702) FK506 binding protein 2
Zebrafish(447939) FK506 binding protein 2
domestic cat(101098162) FK506 binding protein 2, 13kDa
cow(538998) FK506 binding protein 2, 13kDa
dog(483764) FK506 binding protein 2, 13kDa
Goat(100861116) FK506 binding protein 2, 13kDa
sheep(101101847) FK506 binding protein 2, 13kDa
domestic guinea pig(100726001) FK506 binding protein 2, 13kDa
naked mole-rat(101699002) FK506 binding protein 2, 13kDa
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
SAB2108137 Anti-FKBP2 antibody produced in rabbit affinity isolated antibody zebrafish, horse, canine, mouse, bovine, human, guinea pig, rat
western blot pricing
SAB2100817 Anti-FKBP2 antibody produced in rabbit affinity isolated antibody, lyophilized powder mouse, horse, bovine, canine, zebrafish, rat, human
western blot pricing
HPA049405 Anti-FKBP2 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution human
immunofluorescence, immunohistochemistry, western blot pricing
SAB1305439 ANTI-FKBP2(N-TERMINAL) antibody produced in rabbit purified immunoglobulin, buffered aqueous solution human, mouse
flow cytometry, immunohistochemistry, western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_008020 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_008020 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_008020 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_001135208 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001135208 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001135208 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_004470 Rosetta Predictions human pricing
NM_057092 Rosetta Predictions human pricing
NM_001134428 Rosetta Predictions rat pricing
NM_001134429 Rosetta Predictions rat pricing
XM_215196 Rosetta Predictions rat pricing
NM_008020 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_004470 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00245472 predicted 410
2 SASI_Hs01_00245473 predicted 415
3 SASI_Hs01_00245474 predicted 207
4 SASI_Hs01_00245475 predicted 492
5 SASI_Hs02_00337681 predicted 734
6 SASI_Hs01_00245477 predicted 315
7 SASI_Hs01_00245479 predicted 757
8 SASI_Hs01_00245480 predicted 607
9 SASI_Hs01_00245481 predicted 572
10 SASI_Hs02_00337682 predicted 607
11 SASI_Hs01_00245476 predicted 759
12 SASI_Hs01_00245478 predicted 739
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_057092 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00056535 predicted 319
2 SASI_Hs01_00056536 predicted 324
3 SASI_Hs01_00056537 predicted 107
4 SASI_Hs01_00056538 predicted 404
5 SASI_Hs02_00362001 predicted 643
6 SASI_Hs01_00056540 predicted 221
7 SASI_Hs01_00056542 predicted 663
8 SASI_Hs01_00056543 predicted 511
9 SASI_Hs01_00056544 predicted 484
10 SASI_Hs02_00362002 predicted 513
11 SASI_Hs01_00056539 predicted 666
12 SASI_Hs01_00056541 predicted 645
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001134428 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00256319 predicted 293
2 SASI_Rn02_00256320 predicted 303
3 SASI_Rn02_00256321 predicted 298
4 SASI_Rn02_00256322 predicted 325
5 SASI_Rn02_00256323 predicted 207
6 SASI_Rn02_00256324 predicted 261
7 SASI_Rn02_00256325 predicted 454
8 SASI_Rn02_00256326 predicted 489
9 SASI_Rn02_00256327 predicted 104
10 SASI_Rn02_00256328 predicted 204
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001134429 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00256329 predicted 332
2 SASI_Rn02_00256330 predicted 335
3 SASI_Rn02_00256331 predicted 336
4 SASI_Rn02_00256332 predicted 361
5 SASI_Rn02_00256333 predicted 244
6 SASI_Rn02_00256334 predicted 302
7 SASI_Rn02_00256335 predicted 492
8 SASI_Rn02_00256336 predicted 523
9 SASI_Rn02_00256337 predicted 143
10 SASI_Rn02_00256338 predicted 231
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_215196 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00176091 predicted 263
2 SASI_Rn01_00176092 predicted 322
3 SASI_Rn01_00176093 predicted 260
4 SASI_Rn01_00176094 predicted 361
5 SASI_Rn01_00176095 predicted 300
6 SASI_Rn01_00176096 predicted 283
7 SASI_Rn01_00176097 predicted 336
8 SASI_Rn01_00176098 predicted 353
9 SASI_Rn01_00176099 predicted 378
10 SASI_Rn01_00176100 predicted 257
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_008020 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00162367 predicted 213
2 SASI_Mm01_00162368 predicted 241
3 SASI_Mm01_00162369 predicted 229
4 SASI_Mm01_00162371 predicted 279
5 SASI_Mm01_00162372 predicted 207
6 SASI_Mm01_00162373 predicted 213
7 SASI_Mm01_00162374 predicted 205
8 SASI_Mm01_00162375 predicted 263
9 SASI_Mm01_00162376 predicted 278
10 SASI_Mm02_00312964 predicted 228
11 SASI_Mm01_00162370 predicted 209
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_008020
FKBP2 MISSION shRNA Bacterial Glycerol Stock
FK506 binding protein 2, 13kDa
Mouse
4 Products Total
TRC Number Price Set Price (4)? Select
TRCN0000055208    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008020.2-249s1c1
Sequence:CCGGCTAGAAGATGGGACGGAGTTTCTCGAGAAACTCCGTCCCATCTTCTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000055209    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008020.2-194s1c1
Sequence:CCGGCTGTCCTATCAAGTCTAGAAACTCGAGTTTCTAGACTTGATAGGACAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000055210    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008020.2-471s1c1
Sequence:CCGGCTCAAGATTGAGAGACGCTCACTCGAGTGAGCGTCTCTCAATCTTGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000055212    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008020.2-279s1c1
Sequence:CCGGCTACCACAGAACCAGCCCTTTCTCGAGAAAGGGCTGGTTCTGTGGTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_008020
FKBP2 MISSION shRNA shRNA Plasmid DNA
FK506 binding protein 2, 13kDa
Mouse
4 Products Total
TRC Number Vector Price Set Price (4)? Select
TRCN0000055208    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008020.2-249s1c1
Sequence:CCGGCTAGAAGATGGGACGGAGTTTCTCGAGAAACTCCGTCCCATCTTCTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000055209    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008020.2-194s1c1
Sequence:CCGGCTGTCCTATCAAGTCTAGAAACTCGAGTTTCTAGACTTGATAGGACAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000055210    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008020.2-471s1c1
Sequence:CCGGCTCAAGATTGAGAGACGCTCACTCGAGTGAGCGTCTCTCAATCTTGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000055212    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008020.2-279s1c1
Sequence:CCGGCTACCACAGAACCAGCCCTTTCTCGAGAAAGGGCTGGTTCTGTGGTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_008020
FKBP2 MISSION shRNA Lentiviral Transduction Particles
FK506 binding protein 2, 13kDa
Mouse
4 Products Total
TRC Number Volume Titer Vector Price Set Price (4)? Select
TRCN0000055208    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008020.2-249s1c1
Sequence:CCGGCTAGAAGATGGGACGGAGTTTCTCGAGAAACTCCGTCCCATCTTCTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000055209    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008020.2-194s1c1
Sequence:CCGGCTGTCCTATCAAGTCTAGAAACTCGAGTTTCTAGACTTGATAGGACAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000055210    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008020.2-471s1c1
Sequence:CCGGCTCAAGATTGAGAGACGCTCACTCGAGTGAGCGTCTCTCAATCTTGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000055212    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008020.2-279s1c1
Sequence:CCGGCTACCACAGAACCAGCCCTTTCTCGAGAAAGGGCTGGTTCTGTGGTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001135208
VALIDATED
FKBP2 MISSION shRNA Bacterial Glycerol Stock
FK506 binding protein 2, 13kDa
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000242829    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001135208.1-427s21c1
Sequence:CCGGATCCCATCCGAGCTAGGGTATCTCGAGATACCCTAGCTCGGATGGGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000242830    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: A549
TRC Version: 2 Clone ID:NM_001135208.1-290s21c1
Sequence:CCGGTGGAAGATGGGACAGAGTTTGCTCGAGCAAACTCTGTCCCATCTTCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000242832    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 2 Clone ID:NM_001135208.1-324s21c1
Sequence:CCGGCCAGAACCAGCCCTTTGTCTTCTCGAGAAGACAAAGGGCTGGTTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000242833    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 2 Clone ID:NM_001135208.1-261s21c1
Sequence:CCGGTGTCCTGCACATGCACTACACCTCGAGGTGTAGTGCATGTGCAGGACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000242831    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 2 Clone ID:NM_001135208.1-227s21c1
Sequence:CCGGTGGACCACTGTCCCATCAAATCTCGAGATTTGATGGGACAGTGGTCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001135208
VALIDATED
FKBP2 MISSION shRNA shRNA Plasmid DNA
FK506 binding protein 2, 13kDa
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000242829    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001135208.1-427s21c1
Sequence:CCGGATCCCATCCGAGCTAGGGTATCTCGAGATACCCTAGCTCGGATGGGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000242830    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: A549
TRC Version: 2 Clone ID:NM_001135208.1-290s21c1
Sequence:CCGGTGGAAGATGGGACAGAGTTTGCTCGAGCAAACTCTGTCCCATCTTCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000242832    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 2 Clone ID:NM_001135208.1-324s21c1
Sequence:CCGGCCAGAACCAGCCCTTTGTCTTCTCGAGAAGACAAAGGGCTGGTTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000242833    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 2 Clone ID:NM_001135208.1-261s21c1
Sequence:CCGGTGTCCTGCACATGCACTACACCTCGAGGTGTAGTGCATGTGCAGGACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000242831    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 2 Clone ID:NM_001135208.1-227s21c1
Sequence:CCGGTGGACCACTGTCCCATCAAATCTCGAGATTTGATGGGACAGTGGTCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001135208
VALIDATED
FKBP2 MISSION shRNA Lentiviral Transduction Particles
FK506 binding protein 2, 13kDa
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000242829    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001135208.1-427s21c1
Sequence:CCGGATCCCATCCGAGCTAGGGTATCTCGAGATACCCTAGCTCGGATGGGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000242830    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: A549
TRC Version: 2 Clone ID:NM_001135208.1-290s21c1
Sequence:CCGGTGGAAGATGGGACAGAGTTTGCTCGAGCAAACTCTGTCCCATCTTCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000242832    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 2 Clone ID:NM_001135208.1-324s21c1
Sequence:CCGGCCAGAACCAGCCCTTTGTCTTCTCGAGAAGACAAAGGGCTGGTTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000242833    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 2 Clone ID:NM_001135208.1-261s21c1
Sequence:CCGGTGTCCTGCACATGCACTACACCTCGAGGTGTAGTGCATGTGCAGGACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000242831    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 2 Clone ID:NM_001135208.1-227s21c1
Sequence:CCGGTGGACCACTGTCCCATCAAATCTCGAGATTTGATGGGACAGTGGTCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks