EMAIL THIS PAGE TO A FRIEND

FKBP3

FK506 binding protein 3, 25kDa

81 Gene Product Result for
Synonyms: FKBP-25 FKBP-3 FKBP25 PPIase
UniProtKB ID: Q00688, B2R4Q9, Q14317
Gene ID:
Human(2287) Summary: The protein encoded by this gene is a member of the immunophilin protein family, which play a role in immunoregulation and basic cellular processes involving protein folding and trafficking. This encoded protein is a cis-trans prolyl isomerase that binds the immunosuppressants FK506 and rapamycin, as well as histone deacetylases, the transcription factor YY1, casein kinase II, and nucleolin. It has a higher affinity for rapamycin than for FK506 and thus may be an important target molecule for immunosuppression by rapamycin. [provided by RefSeq, Sep 2008]
Mouse(30795) FK506 binding protein 3
Rat(299104) FK506 binding protein 3
sheep(101109649) FK506 binding protein 3, 25kDa
naked mole-rat(101714079) FK506 binding protein 3, 25kDa
domestic guinea pig(100714860) FK506 binding protein 3, 25kDa
Zebrafish(368863) FK506 binding protein 3
chicken(395353) FK506 binding protein 3, 25kDa
cow(515069) FK506 binding protein 3, 25kDa
domestic cat(101089273) FK506 binding protein 3, 25kDa
dog(480306) FK506 binding protein 3, 25kDa
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
HPA000864 Anti-FKBP3 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution rat, mouse, human
immunofluorescence, immunohistochemistry, western blot pricing
SAB2100818 Anti-FKBP3 antibody produced in rabbit affinity isolated antibody zebrafish, bovine, canine, rabbit, rat, guinea pig, horse, human, mouse, rabbit
western blot pricing
SAB1410392 Anti-FKBP3 antibody produced in rabbit purified immunoglobulin, buffered aqueous solution human
ELISA, western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_013902 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_013902 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_013902 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_002013 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_002013 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_002013 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_002013 Rosetta Predictions human pricing
NM_001106736 Rosetta Predictions rat pricing
NM_013902 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_002013 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00054412 predicted 1094
2 SASI_Hs01_00054413 predicted 983
3 SASI_Hs01_00054415 predicted 982
4 SASI_Hs01_00054416 predicted 1102
5 SASI_Hs01_00054417 predicted 503
6 SASI_Hs01_00054419 predicted 795
7 SASI_Hs01_00054420 predicted 1056
8 SASI_Hs01_00054421 predicted 810
9 SASI_Hs02_00333013 predicted 693
10 SASI_Hs02_00333014 predicted 807
11 SASI_Hs01_00054414 predicted 1160
12 SASI_Hs01_00054418 predicted 531
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001106736 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00221888 predicted 1057
2 SASI_Rn02_00221889 predicted 889
3 SASI_Rn02_00221890 predicted 1020
4 SASI_Rn02_00221891 predicted 988
5 SASI_Rn02_00221892 predicted 934
6 SASI_Rn02_00221893 predicted 911
7 SASI_Rn02_00221894 predicted 797
8 SASI_Rn02_00221895 predicted 1033
9 SASI_Rn02_00221896 predicted 971
10 SASI_Rn02_00221897 predicted 924
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_013902 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00322978 predicted 679
2 SASI_Mm02_00322979 predicted 542
3 SASI_Mm01_00115775 predicted 590
4 SASI_Mm02_00322980 predicted 224
5 SASI_Mm02_00322981 predicted 536
6 SASI_Mm02_00322982 predicted 278
7 SASI_Mm02_00322983 predicted 241
8 SASI_Mm02_00322984 predicted 706
9 SASI_Mm01_00115783 predicted 395
10 SASI_Mm02_00322985 predicted 222
11 SASI_Mm01_00115776 predicted 300
12 SASI_Mm01_00115777 predicted 489
13 SASI_Mm01_00115778 predicted 540
14 SASI_Mm01_00115779 predicted 214
15 SASI_Mm01_00115780 predicted 531
16 SASI_Mm01_00115781 predicted 723
17 SASI_Mm01_00115782 predicted 625
18 SASI_Mm01_00115784 predicted 731
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_013902
VALIDATED
FKBP3 MISSION shRNA Bacterial Glycerol Stock
FK506 binding protein 3, 25kDa
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000354030    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013902.4-548s21c1
Sequence:CCGGGCGCTCTTGACTATGAGTAAACTCGAGTTTACTCATAGTCAAGAGCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000324985    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_013902.4-835s21c1
Sequence:CCGGCCCTTTAAGTCTCAGATATTTCTCGAGAAATATCTGAGACTTAAAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000324983    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013902.4-299s21c1
Sequence:CCGGCCCAAAGACTCCAAGTCTGAACTCGAGTTCAGACTTGGAGTCTTTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000325057    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013902.4-187s21c1
Sequence:CCGGCCATTTGGTTAATGCCTATAACTCGAGTTATAGGCATTAACCAAATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000100970    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_013902.2-859s1c1
Sequence:CCGGCCCTTTAAGTCTCAGATATTTCTCGAGAAATATCTGAGACTTAAAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000100974    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_013902.2-323s1c1
Sequence:CCGGCCCAAAGACTCCAAGTCTGAACTCGAGTTCAGACTTGGAGTCTTTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000100973    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_013902.2-155s1c1
Sequence:CCGGGCAGAGCATAAATTACTGGGACTCGAGTCCCAGTAATTTATGCTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000100971    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013902.2-211s1c1
Sequence:CCGGCCATTTGGTTAATGCCTATAACTCGAGTTATAGGCATTAACCAAATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000100972    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_013902.2-572s1c1
Sequence:CCGGGCGCTCTTGACTATGAGTAAACTCGAGTTTACTCATAGTCAAGAGCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_013902
VALIDATED
FKBP3 MISSION shRNA shRNA Plasmid DNA
FK506 binding protein 3, 25kDa
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000354030    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013902.4-548s21c1
Sequence:CCGGGCGCTCTTGACTATGAGTAAACTCGAGTTTACTCATAGTCAAGAGCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000324985    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_013902.4-835s21c1
Sequence:CCGGCCCTTTAAGTCTCAGATATTTCTCGAGAAATATCTGAGACTTAAAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000324983    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013902.4-299s21c1
Sequence:CCGGCCCAAAGACTCCAAGTCTGAACTCGAGTTCAGACTTGGAGTCTTTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000325057    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013902.4-187s21c1
Sequence:CCGGCCATTTGGTTAATGCCTATAACTCGAGTTATAGGCATTAACCAAATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000100970    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_013902.2-859s1c1
Sequence:CCGGCCCTTTAAGTCTCAGATATTTCTCGAGAAATATCTGAGACTTAAAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000100974    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_013902.2-323s1c1
Sequence:CCGGCCCAAAGACTCCAAGTCTGAACTCGAGTTCAGACTTGGAGTCTTTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000100973    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_013902.2-155s1c1
Sequence:CCGGGCAGAGCATAAATTACTGGGACTCGAGTCCCAGTAATTTATGCTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000100971    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013902.2-211s1c1
Sequence:CCGGCCATTTGGTTAATGCCTATAACTCGAGTTATAGGCATTAACCAAATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000100972    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_013902.2-572s1c1
Sequence:CCGGGCGCTCTTGACTATGAGTAAACTCGAGTTTACTCATAGTCAAGAGCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_013902
VALIDATED
FKBP3 MISSION shRNA Lentiviral Transduction Particles
FK506 binding protein 3, 25kDa
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000354030    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013902.4-548s21c1
Sequence:CCGGGCGCTCTTGACTATGAGTAAACTCGAGTTTACTCATAGTCAAGAGCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000324985    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_013902.4-835s21c1
Sequence:CCGGCCCTTTAAGTCTCAGATATTTCTCGAGAAATATCTGAGACTTAAAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000324983    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013902.4-299s21c1
Sequence:CCGGCCCAAAGACTCCAAGTCTGAACTCGAGTTCAGACTTGGAGTCTTTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000325057    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013902.4-187s21c1
Sequence:CCGGCCATTTGGTTAATGCCTATAACTCGAGTTATAGGCATTAACCAAATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000100970    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_013902.2-859s1c1
Sequence:CCGGCCCTTTAAGTCTCAGATATTTCTCGAGAAATATCTGAGACTTAAAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000100974    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_013902.2-323s1c1
Sequence:CCGGCCCAAAGACTCCAAGTCTGAACTCGAGTTCAGACTTGGAGTCTTTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000100973    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_013902.2-155s1c1
Sequence:CCGGGCAGAGCATAAATTACTGGGACTCGAGTCCCAGTAATTTATGCTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000100971    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013902.2-211s1c1
Sequence:CCGGCCATTTGGTTAATGCCTATAACTCGAGTTATAGGCATTAACCAAATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000100972    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_013902.2-572s1c1
Sequence:CCGGGCGCTCTTGACTATGAGTAAACTCGAGTTTACTCATAGTCAAGAGCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_002013
VALIDATED
FKBP3 MISSION shRNA Bacterial Glycerol Stock
FK506 binding protein 3, 25kDa
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000333870    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002013.3-244s21c1
Sequence:CCGGCCACTTGGTTACAGCCTATAACTCGAGTTATAGGCTGTAACCAAGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000333793    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002013.3-486s21c1
Sequence:CCGGCACTACAAGATGGGACTGTTTCTCGAGAAACAGTCCCATCTTGTAGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000333792    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002013.3-356s21c1
Sequence:CCGGCCCAAAGAAACCAAGTCTGAACTCGAGTTCAGACTTGGTTTCTTTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000333869    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002013.3-176s21c1
Sequence:CCGGGATTCGTTTCTTGCAGAACATCTCGAGATGTTCTGCAAGAAACGAATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000063541    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: A549
TRC Version: 1 Clone ID:NM_002013.2-514s1c1
Sequence:CCGGGATTCGTTTCTTGCAGAACATCTCGAGATGTTCTGCAAGAAACGAATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000063542    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: A549
TRC Version: 1 Clone ID:NM_002013.2-1060s1c1
Sequence:CCGGGAAGTGGAATTAGTGGATATTCTCGAGAATATCCACTAATTCCACTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000063538    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: A549
TRC Version: 1 Clone ID:NM_002013.2-824s1c1
Sequence:CCGGCACTACAAGATGGGACTGTTTCTCGAGAAACAGTCCCATCTTGTAGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000063540    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 1 Clone ID:NM_002013.2-694s1c1
Sequence:CCGGCCCAAAGAAACCAAGTCTGAACTCGAGTTCAGACTTGGTTTCTTTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000063539    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 1 Clone ID:NM_002013.2-582s1c1
Sequence:CCGGCCACTTGGTTACAGCCTATAACTCGAGTTATAGGCTGTAACCAAGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_002013
VALIDATED
FKBP3 MISSION shRNA shRNA Plasmid DNA
FK506 binding protein 3, 25kDa
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000333870    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002013.3-244s21c1
Sequence:CCGGCCACTTGGTTACAGCCTATAACTCGAGTTATAGGCTGTAACCAAGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000333793    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002013.3-486s21c1
Sequence:CCGGCACTACAAGATGGGACTGTTTCTCGAGAAACAGTCCCATCTTGTAGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000333792    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002013.3-356s21c1
Sequence:CCGGCCCAAAGAAACCAAGTCTGAACTCGAGTTCAGACTTGGTTTCTTTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000333869    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002013.3-176s21c1
Sequence:CCGGGATTCGTTTCTTGCAGAACATCTCGAGATGTTCTGCAAGAAACGAATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000063541    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: A549
TRC Version: 1 Clone ID:NM_002013.2-514s1c1
Sequence:CCGGGATTCGTTTCTTGCAGAACATCTCGAGATGTTCTGCAAGAAACGAATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000063542    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: A549
TRC Version: 1 Clone ID:NM_002013.2-1060s1c1
Sequence:CCGGGAAGTGGAATTAGTGGATATTCTCGAGAATATCCACTAATTCCACTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000063538    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: A549
TRC Version: 1 Clone ID:NM_002013.2-824s1c1
Sequence:CCGGCACTACAAGATGGGACTGTTTCTCGAGAAACAGTCCCATCTTGTAGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000063540    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 1 Clone ID:NM_002013.2-694s1c1
Sequence:CCGGCCCAAAGAAACCAAGTCTGAACTCGAGTTCAGACTTGGTTTCTTTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000063539    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 1 Clone ID:NM_002013.2-582s1c1
Sequence:CCGGCCACTTGGTTACAGCCTATAACTCGAGTTATAGGCTGTAACCAAGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_002013
VALIDATED
FKBP3 MISSION shRNA Lentiviral Transduction Particles
FK506 binding protein 3, 25kDa
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000333870    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002013.3-244s21c1
Sequence:CCGGCCACTTGGTTACAGCCTATAACTCGAGTTATAGGCTGTAACCAAGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000333793    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002013.3-486s21c1
Sequence:CCGGCACTACAAGATGGGACTGTTTCTCGAGAAACAGTCCCATCTTGTAGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000333792    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002013.3-356s21c1
Sequence:CCGGCCCAAAGAAACCAAGTCTGAACTCGAGTTCAGACTTGGTTTCTTTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000333869    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002013.3-176s21c1
Sequence:CCGGGATTCGTTTCTTGCAGAACATCTCGAGATGTTCTGCAAGAAACGAATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000063541    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: A549
TRC Version: 1 Clone ID:NM_002013.2-514s1c1
Sequence:CCGGGATTCGTTTCTTGCAGAACATCTCGAGATGTTCTGCAAGAAACGAATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000063542    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: A549
TRC Version: 1 Clone ID:NM_002013.2-1060s1c1
Sequence:CCGGGAAGTGGAATTAGTGGATATTCTCGAGAATATCCACTAATTCCACTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000063538    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: A549
TRC Version: 1 Clone ID:NM_002013.2-824s1c1
Sequence:CCGGCACTACAAGATGGGACTGTTTCTCGAGAAACAGTCCCATCTTGTAGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000063540    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 1 Clone ID:NM_002013.2-694s1c1
Sequence:CCGGCCCAAAGAAACCAAGTCTGAACTCGAGTTCAGACTTGGTTTCTTTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000063539    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 1 Clone ID:NM_002013.2-582s1c1
Sequence:CCGGCCACTTGGTTACAGCCTATAACTCGAGTTATAGGCTGTAACCAAGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks