EMAIL THIS PAGE TO A FRIEND

FKBP4

FK506 binding protein 4, 59kDa

Synonyms: FKBP51 FKBP52 FKBP59 HBI Hsp56 PPIase p52
UniProtKB ID: Q02790, D3DUQ1, Q9UCP1, Q9UCV7
Gene ID:
Human(2288) Summary: The protein encoded by this gene is a member of the immunophilin protein family, which play a role in immunoregulation and basic cellular processes involving protein folding and trafficking. This encoded protein is a cis-trans prolyl isomerase that binds to the immunosuppressants FK506 and rapamycin. It has high structural and functional similarity to FK506-binding protein 1A (FKBP1A), but unlike FKBP1A, this protein does not have immunosuppressant activity when complexed with FK506. It interacts with interferon regulatory factor-4 and plays an important role in immunoregulatory gene expression in B and T lymphocytes. This encoded protein is known to associate with phytanoyl-CoA alpha-hydroxylase. It can also associate with two heat shock proteins (hsp90 and hsp70) and thus may play a role in the intracellular trafficking of hetero-oligomeric forms of the steroid hormone receptors. This protein correlates strongly with adeno-associated virus type 2 vectors (AAV) resulting in a significant increase in AAV-mediated transgene expression in human cell lines. Thus this encoded protein is thought to have important implications for the optimal use of AAV vectors in human gene therapy. The human genome contains several non-transcribed pseudogenes similar to this gene. [provided by RefSeq, Sep 2008]
Mouse(14228) FK506 binding protein 4
Rat(260321) FK506 binding protein 4
Zebrafish(321795) FK506 binding protein 4
cow(508535) FK506 binding protein 4, 59kDa
domestic cat(101098306) FK506 binding protein 4, 59kDa
dog(477726) FK506 binding protein 4, 59kDa
chicken(418261) FK506 binding protein 4, 59kDa
naked mole-rat(101711168) FK506 binding protein 4, 59kDa
sheep(101114010) FK506 binding protein 4, 59kDa
Domestic Rabbit(100009148) FK506 binding protein 4, 59kDa
120 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_002014 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_002014 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_002014 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_010219 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_010219 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_010219 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_002014 Rosetta Predictions human pricing
XM_001066628 Rosetta Predictions rat pricing
XM_342763 Rosetta Predictions rat pricing
NM_010219 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_002014 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00022282 predicted 859
2 SASI_Hs01_00022283 predicted 790
3 SASI_Hs01_00022284 predicted 580
4 SASI_Hs01_00022285 predicted 1376
5 SASI_Hs01_00022286 predicted 982
6 SASI_Hs01_00022287 predicted 1200
7 SASI_Hs02_00333015 predicted 920
8 SASI_Hs01_00022288 predicted 881
9 SASI_Hs01_00022289 predicted 1154
10 SASI_Hs01_00022290 predicted 673
11 SASI_Hs01_00022291 predicted 573
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001066628 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00318201 predicted 1189
2 SASI_Rn02_00318202 predicted 562
3 SASI_Rn02_00318203 predicted 1459
4 SASI_Rn02_00318204 predicted 635
5 SASI_Rn02_00318205 predicted 1356
6 SASI_Rn02_00318206 predicted 652
7 SASI_Rn02_00318207 predicted 980
8 SASI_Rn02_00318208 predicted 1088
9 SASI_Rn02_00318209 predicted 1767
10 SASI_Rn02_00318210 predicted 216
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_342763 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00394761 predicted 1031
2 SASI_Rn02_00394762 predicted 399
3 SASI_Rn02_00394763 predicted 1297
4 SASI_Rn02_00394764 predicted 485
5 SASI_Rn02_00394765 predicted 1190
6 SASI_Rn02_00394766 predicted 493
7 SASI_Rn02_00394767 predicted 824
8 SASI_Rn02_00394768 predicted 929
9 SASI_Rn02_00394769 predicted 1609
10 SASI_Rn02_00394770 predicted 956
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_010219 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00040410 predicted 971
2 SASI_Mm01_00040411 predicted 846
3 SASI_Mm01_00040412 predicted 1447
4 SASI_Mm01_00040413 predicted 1587
5 SASI_Mm01_00040414 predicted 218
6 SASI_Mm02_00318067 predicted 1117
7 SASI_Mm02_00318068 predicted 980
8 SASI_Mm01_00040416 predicted 1426
9 SASI_Mm01_00040417 predicted 1001
10 SASI_Mm01_00040418 predicted 298
11 SASI_Mm01_00040415 predicted 777
12 SASI_Mm01_00040419 predicted 1171
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_002014
VALIDATED
FKBP4 MISSION shRNA Bacterial Glycerol Stock
FK506 binding protein 4, 59kDa
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000157796    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_002014.2-781s1c1
Sequence:CCGGCGCATGGAGAAAGGAGAACATCTCGAGATGTTCTCCTTTCTCCATGCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000157250    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: A549
TRC Version: 1 Clone ID:NM_002014.2-628s1c1
Sequence:CCGGGAAGGCTATGCTAAGCCCAATCTCGAGATTGGGCTTAGCATAGCCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000152553    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.86 Cell Line: A549
TRC Version: 1 Clone ID:NM_002014.2-2037s1c1
Sequence:CCGGGATGATGTCTTCTGGTGTCATCTCGAGATGACACCAGAAGACATCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000152554    
Product Details
Validated
Region:CDS Mean KnockDown Level: 1.0 Cell Line: A549
TRC Version: 1 Clone ID:NM_002014.2-782s1c1
Sequence:CCGGGCATGGAGAAAGGAGAACATTCTCGAGAATGTTCTCCTTTCTCCATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000152465    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 1 Clone ID:NM_002014.2-370s1c1
Sequence:CCGGCGCAAGGACAAATTCTCCTTTCTCGAGAAAGGAGAATTTGTCCTTGCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000280604    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 2 Clone ID:NM_002014.3-827s21c1
Sequence:CCGGGCATGGAGAAAGGAGAACATTCTCGAGAATGTTCTCCTTTCTCCATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000280603    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 2 Clone ID:NM_002014.3-415s21c1
Sequence:CCGGCGCAAGGACAAATTCTCCTTTCTCGAGAAAGGAGAATTTGTCCTTGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000280665    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_002014.3-2082s21c1
Sequence:CCGGGATGATGTCTTCTGGTGTCATCTCGAGATGACACCAGAAGACATCATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000297876    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: A549
TRC Version: 2 Clone ID:NM_002014.3-1419s21c1
Sequence:CCGGGAAGAAGCTCTATGCCAATATCTCGAGATATTGGCATAGAGCTTCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_002014
VALIDATED
FKBP4 MISSION shRNA shRNA Plasmid DNA
FK506 binding protein 4, 59kDa
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000157796    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_002014.2-781s1c1
Sequence:CCGGCGCATGGAGAAAGGAGAACATCTCGAGATGTTCTCCTTTCTCCATGCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000157250    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: A549
TRC Version: 1 Clone ID:NM_002014.2-628s1c1
Sequence:CCGGGAAGGCTATGCTAAGCCCAATCTCGAGATTGGGCTTAGCATAGCCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000152553    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.86 Cell Line: A549
TRC Version: 1 Clone ID:NM_002014.2-2037s1c1
Sequence:CCGGGATGATGTCTTCTGGTGTCATCTCGAGATGACACCAGAAGACATCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000152554    
Product Details
Validated
Region:CDS Mean KnockDown Level: 1.0 Cell Line: A549
TRC Version: 1 Clone ID:NM_002014.2-782s1c1
Sequence:CCGGGCATGGAGAAAGGAGAACATTCTCGAGAATGTTCTCCTTTCTCCATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000152465    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 1 Clone ID:NM_002014.2-370s1c1
Sequence:CCGGCGCAAGGACAAATTCTCCTTTCTCGAGAAAGGAGAATTTGTCCTTGCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000280604    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 2 Clone ID:NM_002014.3-827s21c1
Sequence:CCGGGCATGGAGAAAGGAGAACATTCTCGAGAATGTTCTCCTTTCTCCATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000280603    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 2 Clone ID:NM_002014.3-415s21c1
Sequence:CCGGCGCAAGGACAAATTCTCCTTTCTCGAGAAAGGAGAATTTGTCCTTGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000280665    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_002014.3-2082s21c1
Sequence:CCGGGATGATGTCTTCTGGTGTCATCTCGAGATGACACCAGAAGACATCATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000297876    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: A549
TRC Version: 2 Clone ID:NM_002014.3-1419s21c1
Sequence:CCGGGAAGAAGCTCTATGCCAATATCTCGAGATATTGGCATAGAGCTTCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_002014
VALIDATED
FKBP4 MISSION shRNA Lentiviral Transduction Particles
FK506 binding protein 4, 59kDa
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000157796    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_002014.2-781s1c1
Sequence:CCGGCGCATGGAGAAAGGAGAACATCTCGAGATGTTCTCCTTTCTCCATGCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000157250    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: A549
TRC Version: 1 Clone ID:NM_002014.2-628s1c1
Sequence:CCGGGAAGGCTATGCTAAGCCCAATCTCGAGATTGGGCTTAGCATAGCCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000152553    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.86 Cell Line: A549
TRC Version: 1 Clone ID:NM_002014.2-2037s1c1
Sequence:CCGGGATGATGTCTTCTGGTGTCATCTCGAGATGACACCAGAAGACATCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000152554    
Product Details
Validated
Region:CDS Mean KnockDown Level: 1.0 Cell Line: A549
TRC Version: 1 Clone ID:NM_002014.2-782s1c1
Sequence:CCGGGCATGGAGAAAGGAGAACATTCTCGAGAATGTTCTCCTTTCTCCATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000152465    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 1 Clone ID:NM_002014.2-370s1c1
Sequence:CCGGCGCAAGGACAAATTCTCCTTTCTCGAGAAAGGAGAATTTGTCCTTGCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000280604    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 2 Clone ID:NM_002014.3-827s21c1
Sequence:CCGGGCATGGAGAAAGGAGAACATTCTCGAGAATGTTCTCCTTTCTCCATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000280603    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 2 Clone ID:NM_002014.3-415s21c1
Sequence:CCGGCGCAAGGACAAATTCTCCTTTCTCGAGAAAGGAGAATTTGTCCTTGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000280665    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_002014.3-2082s21c1
Sequence:CCGGGATGATGTCTTCTGGTGTCATCTCGAGATGACACCAGAAGACATCATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000297876    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: A549
TRC Version: 2 Clone ID:NM_002014.3-1419s21c1
Sequence:CCGGGAAGAAGCTCTATGCCAATATCTCGAGATATTGGCATAGAGCTTCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_010219
VALIDATED
FKBP4 MISSION shRNA Bacterial Glycerol Stock
FK506 binding protein 4, 59kDa
Mouse
11 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000111860    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.59 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010219.2-1708s1c1
Sequence:CCGGCCCGTTACACACAAGTGTATACTCGAGTATACACTTGTGTGTAACGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000111864    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010219.2-301s1c1
Sequence:CCGGGCTGCTAGATGGCACAAAGTTCTCGAGAACTTTGTGCCATCTAGCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000111863    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010219.2-1014s1c1
Sequence:CCGGCTTGGCTAGAATACGAGTCTACTCGAGTAGACTCGTATTCTAGCCAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000111861    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010219.2-781s1c1
Sequence:CCGGCCTCAAACCTAGCTATGCTTTCTCGAGAAAGCATAGCTAGGTTTGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000111862    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010219.2-771s1c1
Sequence:CCGGCCATCGTGTACCTCAAACCTACTCGAGTAGGTTTGAGGTACACGATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000377053    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.78 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_010219.3-1583s21c1
Sequence:CCGGTTTGAGTGAATTAGACCTTTACTCGAGTAAAGGTCTAATTCACTCAAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000377054    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.69 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_010219.3-1964s21c1
Sequence:CCGGTGCTCTCCTGAGTTGGTATTCCTCGAGGAATACCAACTCAGGAGAGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000348711    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_010219.3-378s21c1
Sequence:CCGGTCATCAAGGCTTGGGATATTGCTCGAGCAATATCCCAAGCCTTGATGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000351875    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_010219.3-781s21c1
Sequence:CCGGCCTCAAACCTAGCTATGCTTTCTCGAGAAAGCATAGCTAGGTTTGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000351946    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_010219.3-771s21c1
Sequence:CCGGCCATCGTGTACCTCAAACCTACTCGAGTAGGTTTGAGGTACACGATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000367654    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010219.3-301s21c1
Sequence:CCGGGCTGCTAGATGGCACAAAGTTCTCGAGAACTTTGTGCCATCTAGCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_010219
VALIDATED
FKBP4 MISSION shRNA shRNA Plasmid DNA
FK506 binding protein 4, 59kDa
Mouse
11 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000111860    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.59 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010219.2-1708s1c1
Sequence:CCGGCCCGTTACACACAAGTGTATACTCGAGTATACACTTGTGTGTAACGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000111864    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010219.2-301s1c1
Sequence:CCGGGCTGCTAGATGGCACAAAGTTCTCGAGAACTTTGTGCCATCTAGCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000111863    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010219.2-1014s1c1
Sequence:CCGGCTTGGCTAGAATACGAGTCTACTCGAGTAGACTCGTATTCTAGCCAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000111861    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010219.2-781s1c1
Sequence:CCGGCCTCAAACCTAGCTATGCTTTCTCGAGAAAGCATAGCTAGGTTTGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000111862    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010219.2-771s1c1
Sequence:CCGGCCATCGTGTACCTCAAACCTACTCGAGTAGGTTTGAGGTACACGATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000377053    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.78 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_010219.3-1583s21c1
Sequence:CCGGTTTGAGTGAATTAGACCTTTACTCGAGTAAAGGTCTAATTCACTCAAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000377054    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.69 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_010219.3-1964s21c1
Sequence:CCGGTGCTCTCCTGAGTTGGTATTCCTCGAGGAATACCAACTCAGGAGAGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000348711    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_010219.3-378s21c1
Sequence:CCGGTCATCAAGGCTTGGGATATTGCTCGAGCAATATCCCAAGCCTTGATGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000351875    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_010219.3-781s21c1
Sequence:CCGGCCTCAAACCTAGCTATGCTTTCTCGAGAAAGCATAGCTAGGTTTGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000351946    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_010219.3-771s21c1
Sequence:CCGGCCATCGTGTACCTCAAACCTACTCGAGTAGGTTTGAGGTACACGATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000367654    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010219.3-301s21c1
Sequence:CCGGGCTGCTAGATGGCACAAAGTTCTCGAGAACTTTGTGCCATCTAGCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_010219
VALIDATED
FKBP4 MISSION shRNA Lentiviral Transduction Particles
FK506 binding protein 4, 59kDa
Mouse
11 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000111860    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.59 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010219.2-1708s1c1
Sequence:CCGGCCCGTTACACACAAGTGTATACTCGAGTATACACTTGTGTGTAACGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000111864    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010219.2-301s1c1
Sequence:CCGGGCTGCTAGATGGCACAAAGTTCTCGAGAACTTTGTGCCATCTAGCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000111863    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010219.2-1014s1c1
Sequence:CCGGCTTGGCTAGAATACGAGTCTACTCGAGTAGACTCGTATTCTAGCCAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000111861    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010219.2-781s1c1
Sequence:CCGGCCTCAAACCTAGCTATGCTTTCTCGAGAAAGCATAGCTAGGTTTGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000111862    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010219.2-771s1c1
Sequence:CCGGCCATCGTGTACCTCAAACCTACTCGAGTAGGTTTGAGGTACACGATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000377053    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.78 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_010219.3-1583s21c1
Sequence:CCGGTTTGAGTGAATTAGACCTTTACTCGAGTAAAGGTCTAATTCACTCAAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000377054    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.69 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_010219.3-1964s21c1
Sequence:CCGGTGCTCTCCTGAGTTGGTATTCCTCGAGGAATACCAACTCAGGAGAGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000348711    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_010219.3-378s21c1
Sequence:CCGGTCATCAAGGCTTGGGATATTGCTCGAGCAATATCCCAAGCCTTGATGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000351875    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_010219.3-781s21c1
Sequence:CCGGCCTCAAACCTAGCTATGCTTTCTCGAGAAAGCATAGCTAGGTTTGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000351946    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_010219.3-771s21c1
Sequence:CCGGCCATCGTGTACCTCAAACCTACTCGAGTAGGTTTGAGGTACACGATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000367654    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010219.3-301s21c1
Sequence:CCGGGCTGCTAGATGGCACAAAGTTCTCGAGAACTTTGTGCCATCTAGCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks