EMAIL THIS PAGE TO A FRIEND

FKBP5

FK506 binding protein 5

200 Gene Product Result for
Synonyms: AIG6 FKBP51 FKBP54 P54 PPIase Ptg-10
UniProtKB ID: Q13451, F5H7R1, Q59EB8, Q5TGM6
Gene ID:
Human(2289) Summary: The protein encoded by this gene is a member of the immunophilin protein family, which play a role in immunoregulation and basic cellular processes involving protein folding and trafficking. This encoded protein is a cis-trans prolyl isomerase that binds to the immunosuppressants FK506 and rapamycin. It is thought to mediate calcineurin inhibition. It also interacts functionally with mature hetero-oligomeric progesterone receptor complexes along with the 90 kDa heat shock protein and P23 protein. This gene has been found to have multiple polyadenylation sites. Alternative splicing results in multiple transcript variants.[provided by RefSeq, Mar 2009]
Mouse(14229) FK506 binding protein 5
Rat(361810) FK506 binding protein 5
Zebrafish(368924) FK506 binding protein 5
chicken(421186) FK506 binding protein 5
dog(481759) FK506 binding protein 5
cow(535704) FK506 binding protein 5
Horse(100053546) FK506 binding protein 5
domestic cat(101099715) FK506 binding protein 5
sheep(101118565) FK506 binding protein 5
Domestic Rabbit(100339155) FK506 binding protein 5
naked mole-rat(101718430) FK506 binding protein 5
domestic guinea pig(100724035) FK506 binding protein 5
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
F7181 Anti-FKBP5 (411-425) antibody produced in rabbit IgG fraction of antiserum, buffered aqueous solution human
western blot pricing
F7056 Anti-FKBP5 (51-65) antibody produced in rabbit IgG fraction of antiserum, buffered aqueous solution human
western blot pricing
SAB1405814 Anti-FKBP5 antibody produced in mouse purified immunoglobulin, buffered aqueous solution human
immunofluorescence, immunohistochemistry, western blot pricing
SAB2100820 Anti-FKBP5 antibody produced in rabbit affinity isolated antibody horse, rat, bovine, rabbit, pig, zebrafish, human, rabbit, guinea pig, canine, mouse
western blot pricing
HPA031092 Anti-FKBP5 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution, ab1 human
immunohistochemistry, western blot pricing
HPA031093 Anti-FKBP5 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution, ab2 human, rat, mouse
immunofluorescence, immunohistochemistry, western blot pricing
HPA031095 Anti-FKBP5 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution human
immunohistochemistry, western blot pricing
WH0002289M2 Monoclonal Anti-FKBP5 antibody produced in mouse clone 3D1-1B10, purified immunoglobulin, buffered aqueous solution human
ELISA, western blot pricing
SAB1403822 Monoclonal Anti-FKBP5 antibody produced in mouse clone 3D10-1G11, purified immunoglobulin, buffered aqueous solution human
ELISA, western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_010220 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_010220 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_010220 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_004117 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_004117 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_004117 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_004117 Rosetta Predictions human pricing
NM_001012174 Rosetta Predictions rat pricing
XM_574724 Rosetta Predictions rat pricing
NM_010220 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_004117 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00151412 predicted 842
2 SASI_Hs01_00151413 predicted 292
3 SASI_Hs01_00151417 predicted 1366
4 SASI_Hs01_00151419 predicted 1595
5 SASI_Hs01_00151420 predicted 1265
6 SASI_Hs02_00336958 predicted 1424
7 SASI_Hs02_00336959 predicted 652
8 SASI_Hs02_00336960 predicted 1424
9 SASI_Hs02_00336961 predicted 1048
10 SASI_Hs02_00336962 predicted 288
11 SASI_Hs01_00151414 predicted 858
12 SASI_Hs01_00151415 predicted 351
13 SASI_Hs01_00151416 predicted 523
14 SASI_Hs01_00151418 predicted 1384
15 SASI_Hs01_00151421 predicted 1012
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001012174 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00093889 predicted 411
2 SASI_Rn01_00093890 predicted 818
3 SASI_Rn01_00093891 predicted 817
4 SASI_Rn01_00093892 predicted 400
5 SASI_Rn01_00093893 predicted 324
6 SASI_Rn02_00200374 predicted 1422
7 SASI_Rn01_00093894 predicted 1561
8 SASI_Rn01_00093897 predicted 1092
9 SASI_Rn01_00093898 predicted 523
10 SASI_Rn02_00200375 predicted 299
11 SASI_Rn01_00093895 predicted 1126
12 SASI_Rn01_00093896 predicted 546
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_574724 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00132832 predicted 515
2 SASI_Rn01_00132833 predicted 925
3 SASI_Rn01_00132834 predicted 924
4 SASI_Rn01_00132835 predicted 506
5 SASI_Rn01_00132836 predicted 432
6 SASI_Rn01_00132837 predicted 1665
7 SASI_Rn01_00132838 predicted 1234
8 SASI_Rn01_00132839 predicted 647
9 SASI_Rn01_00132840 predicted 1207
10 SASI_Rn01_00132841 predicted 627
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_010220 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00134270 predicted 519
2 SASI_Mm01_00134271 predicted 588
3 SASI_Mm01_00134272 predicted 377
4 SASI_Mm01_00134273 predicted 787
5 SASI_Mm01_00134274 predicted 455
6 SASI_Mm01_00134275 predicted 707
7 SASI_Mm01_00134276 predicted 871
8 SASI_Mm01_00134277 predicted 692
9 SASI_Mm01_00134278 predicted 367
10 SASI_Mm01_00134279 predicted 591
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_010220
VALIDATED
FKBP5 MISSION shRNA Bacterial Glycerol Stock
FK506 binding protein 5
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000327481    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_010220.3-1962s21c1
Sequence:CCGGGCGGGTGATGAGATTTGCTTACTCGAGTAAGCAAATCTCATCACCCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000327408    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010220.3-263s21c1
Sequence:CCGGGAAGAAAGACAGAGGAGTATTCTCGAGAATACTCCTCTGTCTTTCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000327334    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010220.3-650s21c1
Sequence:CCGGCGAGGGATACTCAAACCCAAACTCGAGTTTGGGTTTGAGTATCCCTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000327336    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010220.3-549s21c1
Sequence:CCGGCCATCAAATGCAACTCTCTTTCTCGAGAAAGAGAGTTGCATTTGATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000327410    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010220.3-732s21c1
Sequence:CCGGCGAGATGTGGTGTTCGTTGTTCTCGAGAACAACGAACACCACATCTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000111795    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_010220.2-1938s1c1
Sequence:CCGGGCGGGTGATGAGATTTGCTTACTCGAGTAAGCAAATCTCATCACCCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000111799    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010220.2-708s1c1
Sequence:CCGGCGAGATGTGGTGTTCGTTGTTCTCGAGAACAACGAACACCACATCTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000111798    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010220.2-239s1c1
Sequence:CCGGGAAGAAAGACAGAGGAGTATTCTCGAGAATACTCCTCTGTCTTTCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000111796    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010220.2-626s1c1
Sequence:CCGGCGAGGGATACTCAAACCCAAACTCGAGTTTGGGTTTGAGTATCCCTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000111797    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010220.2-525s1c1
Sequence:CCGGCCATCAAATGCAACTCTCTTTCTCGAGAAAGAGAGTTGCATTTGATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_010220
VALIDATED
FKBP5 MISSION shRNA shRNA Plasmid DNA
FK506 binding protein 5
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000327481    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_010220.3-1962s21c1
Sequence:CCGGGCGGGTGATGAGATTTGCTTACTCGAGTAAGCAAATCTCATCACCCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000327408    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010220.3-263s21c1
Sequence:CCGGGAAGAAAGACAGAGGAGTATTCTCGAGAATACTCCTCTGTCTTTCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000327334    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010220.3-650s21c1
Sequence:CCGGCGAGGGATACTCAAACCCAAACTCGAGTTTGGGTTTGAGTATCCCTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000327336    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010220.3-549s21c1
Sequence:CCGGCCATCAAATGCAACTCTCTTTCTCGAGAAAGAGAGTTGCATTTGATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000327410    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010220.3-732s21c1
Sequence:CCGGCGAGATGTGGTGTTCGTTGTTCTCGAGAACAACGAACACCACATCTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000111795    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_010220.2-1938s1c1
Sequence:CCGGGCGGGTGATGAGATTTGCTTACTCGAGTAAGCAAATCTCATCACCCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000111799    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010220.2-708s1c1
Sequence:CCGGCGAGATGTGGTGTTCGTTGTTCTCGAGAACAACGAACACCACATCTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000111798    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010220.2-239s1c1
Sequence:CCGGGAAGAAAGACAGAGGAGTATTCTCGAGAATACTCCTCTGTCTTTCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000111796    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010220.2-626s1c1
Sequence:CCGGCGAGGGATACTCAAACCCAAACTCGAGTTTGGGTTTGAGTATCCCTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000111797    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010220.2-525s1c1
Sequence:CCGGCCATCAAATGCAACTCTCTTTCTCGAGAAAGAGAGTTGCATTTGATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_010220
VALIDATED
FKBP5 MISSION shRNA Lentiviral Transduction Particles
FK506 binding protein 5
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000327481    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_010220.3-1962s21c1
Sequence:CCGGGCGGGTGATGAGATTTGCTTACTCGAGTAAGCAAATCTCATCACCCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000327408    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010220.3-263s21c1
Sequence:CCGGGAAGAAAGACAGAGGAGTATTCTCGAGAATACTCCTCTGTCTTTCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000327334    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010220.3-650s21c1
Sequence:CCGGCGAGGGATACTCAAACCCAAACTCGAGTTTGGGTTTGAGTATCCCTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000327336    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010220.3-549s21c1
Sequence:CCGGCCATCAAATGCAACTCTCTTTCTCGAGAAAGAGAGTTGCATTTGATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000327410    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010220.3-732s21c1
Sequence:CCGGCGAGATGTGGTGTTCGTTGTTCTCGAGAACAACGAACACCACATCTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000111795    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_010220.2-1938s1c1
Sequence:CCGGGCGGGTGATGAGATTTGCTTACTCGAGTAAGCAAATCTCATCACCCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000111799    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010220.2-708s1c1
Sequence:CCGGCGAGATGTGGTGTTCGTTGTTCTCGAGAACAACGAACACCACATCTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000111798    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010220.2-239s1c1
Sequence:CCGGGAAGAAAGACAGAGGAGTATTCTCGAGAATACTCCTCTGTCTTTCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000111796    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010220.2-626s1c1
Sequence:CCGGCGAGGGATACTCAAACCCAAACTCGAGTTTGGGTTTGAGTATCCCTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000111797    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010220.2-525s1c1
Sequence:CCGGCCATCAAATGCAACTCTCTTTCTCGAGAAAGAGAGTTGCATTTGATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_004117
VALIDATED
FKBP5 MISSION shRNA Bacterial Glycerol Stock
FK506 binding protein 5
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000320932    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004117.3-647s21c1
Sequence:CCGGCGAAGGAGCAACAGTAGAAATCTCGAGATTTCTACTGTTGCTCCTTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000320860    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004117.3-614s21c1
Sequence:CCGGCAAACGGAAAGGAGAGGGATACTCGAGTATCCCTCTCCTTTCCGTTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000320933    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004117.3-866s21c1
Sequence:CCGGACCTAATGCTGAGCTTATATACTCGAGTATATAAGCTCAGCATTAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000320930    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004117.3-525s21c1
Sequence:CCGGCCCTCGAATGCAACTCTCTTTCTCGAGAAAGAGAGTTGCATTCGAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000000235    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 1 Clone ID:NM_004117.x-642s1c1
Sequence:CCGGCGAAGGAGCAACAGTAGAAATCTCGAGATTTCTACTGTTGCTCCTTCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000000237    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 1 Clone ID:NM_004117.x-520s1c1
Sequence:CCGGCCCTCGAATGCAACTCTCTTTCTCGAGAAAGAGAGTTGCATTCGAGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000000238    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: A549
TRC Version: 1 Clone ID:NM_004117.x-609s1c1
Sequence:CCGGCAAACGGAAAGGAGAGGGATACTCGAGTATCCCTCTCCTTTCCGTTTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000000236    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: A549
TRC Version: 1 Clone ID:NM_004117.x-376s1c1
Sequence:CCGGGAACCATTTGTCTTTAGTCTTCTCGAGAAGACTAAAGACAAATGGTTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_004117
VALIDATED
FKBP5 MISSION shRNA shRNA Plasmid DNA
FK506 binding protein 5
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000320932    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004117.3-647s21c1
Sequence:CCGGCGAAGGAGCAACAGTAGAAATCTCGAGATTTCTACTGTTGCTCCTTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000320860    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004117.3-614s21c1
Sequence:CCGGCAAACGGAAAGGAGAGGGATACTCGAGTATCCCTCTCCTTTCCGTTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000320933    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004117.3-866s21c1
Sequence:CCGGACCTAATGCTGAGCTTATATACTCGAGTATATAAGCTCAGCATTAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000320930    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004117.3-525s21c1
Sequence:CCGGCCCTCGAATGCAACTCTCTTTCTCGAGAAAGAGAGTTGCATTCGAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000000235    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 1 Clone ID:NM_004117.x-642s1c1
Sequence:CCGGCGAAGGAGCAACAGTAGAAATCTCGAGATTTCTACTGTTGCTCCTTCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000000237    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 1 Clone ID:NM_004117.x-520s1c1
Sequence:CCGGCCCTCGAATGCAACTCTCTTTCTCGAGAAAGAGAGTTGCATTCGAGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000000238    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: A549
TRC Version: 1 Clone ID:NM_004117.x-609s1c1
Sequence:CCGGCAAACGGAAAGGAGAGGGATACTCGAGTATCCCTCTCCTTTCCGTTTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000000236    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: A549
TRC Version: 1 Clone ID:NM_004117.x-376s1c1
Sequence:CCGGGAACCATTTGTCTTTAGTCTTCTCGAGAAGACTAAAGACAAATGGTTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_004117
VALIDATED
FKBP5 MISSION shRNA Lentiviral Transduction Particles
FK506 binding protein 5
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000320932    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004117.3-647s21c1
Sequence:CCGGCGAAGGAGCAACAGTAGAAATCTCGAGATTTCTACTGTTGCTCCTTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000320860    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004117.3-614s21c1
Sequence:CCGGCAAACGGAAAGGAGAGGGATACTCGAGTATCCCTCTCCTTTCCGTTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000320933    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004117.3-866s21c1
Sequence:CCGGACCTAATGCTGAGCTTATATACTCGAGTATATAAGCTCAGCATTAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000320930    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004117.3-525s21c1
Sequence:CCGGCCCTCGAATGCAACTCTCTTTCTCGAGAAAGAGAGTTGCATTCGAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000000235    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 1 Clone ID:NM_004117.x-642s1c1
Sequence:CCGGCGAAGGAGCAACAGTAGAAATCTCGAGATTTCTACTGTTGCTCCTTCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000000237    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 1 Clone ID:NM_004117.x-520s1c1
Sequence:CCGGCCCTCGAATGCAACTCTCTTTCTCGAGAAAGAGAGTTGCATTCGAGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000000238    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: A549
TRC Version: 1 Clone ID:NM_004117.x-609s1c1
Sequence:CCGGCAAACGGAAAGGAGAGGGATACTCGAGTATCCCTCTCCTTTCCGTTTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000000236    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: A549
TRC Version: 1 Clone ID:NM_004117.x-376s1c1
Sequence:CCGGGAACCATTTGTCTTTAGTCTTCTCGAGAAGACTAAAGACAAATGGTTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks