EMAIL THIS PAGE TO A FRIEND

FKBP6

FK506 binding protein 6, 36kDa

54 Gene Product Result for
Synonyms: FKBP36
UniProtKB ID: O75344, B4DXT7, Q9UDS0
Gene ID:
Human(8468) Summary: The protein encoded by this gene is a member of the immunophilin protein family, which play a role in immunoregulation and basic cellular processes involving protein folding and trafficking. The protein may have cis-trans prolyl isomerase activity, and binds to clathrin heavy chain and heat shock protein 72. This gene is found to be deleted in Williams syndrome, and the orthologous gene in mouse is essential for fertility and homologous pairing in male meiosis. [provided by RefSeq, Sep 2008]
Mouse(94244) FK506 binding protein 6
Rat(288597) FK506 binding protein 6
Zebrafish(402839) FK506 binding protein 6
dog(489810) FK506 binding protein 6, 36kDa
chicken(417460) FK506 binding protein 6, 36kDa
cow(537921) FK506 binding protein 6, 36kDa
domestic cat(101087439) FK506 binding protein 6, 36kDa
domestic guinea pig(100728239) FK506 binding protein 6, 36kDa
naked mole-rat(101709090) FK506 binding protein 6, 36kDa
sheep(101116010) FK506 binding protein 6, 36kDa
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_033571 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_033571 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_033571 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_003602 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_003602 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_003602 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU002931 MISSION® esiRNA esiRNA targeting human FKBP6 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_003602 Rosetta Predictions human pricing
NM_001105922 Rosetta Predictions rat pricing
NM_033571 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_003602 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00060624 predicted 1105
2 SASI_Hs01_00060626 predicted 341
3 SASI_Hs01_00060627 predicted 1027
4 SASI_Hs02_00335936 predicted 347
5 SASI_Hs01_00060628 predicted 378
6 SASI_Hs01_00060629 predicted 655
7 SASI_Hs02_00335937 predicted 974
8 SASI_Hs01_00060632 predicted 835
9 SASI_Hs01_00060633 predicted 1020
10 SASI_Hs02_00335938 predicted 685
11 SASI_Hs01_00060625 predicted 916
12 SASI_Hs01_00060630 predicted 1271
13 SASI_Hs01_00060631 predicted 445
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001105922 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00213862 predicted 249
2 SASI_Rn02_00213863 predicted 1129
3 SASI_Rn02_00213864 predicted 238
4 SASI_Rn02_00213865 predicted 737
5 SASI_Rn02_00213866 predicted 212
6 SASI_Rn02_00213867 predicted 430
7 SASI_Rn02_00213868 predicted 956
8 SASI_Rn02_00213869 predicted 693
9 SASI_Rn02_00213870 predicted 550
10 SASI_Rn02_00213871 predicted 1140
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_033571 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00117124 predicted 291
2 SASI_Mm01_00117126 predicted 445
3 SASI_Mm01_00117127 predicted 849
4 SASI_Mm01_00117128 predicted 207
5 SASI_Mm01_00117129 predicted 249
6 SASI_Mm02_00337403 predicted 844
7 SASI_Mm02_00337404 predicted 390
8 SASI_Mm01_00117131 predicted 557
9 SASI_Mm01_00117132 predicted 660
10 SASI_Mm02_00337405 predicted 917
11 SASI_Mm01_00117123 predicted 421
12 SASI_Mm01_00117125 predicted 709
13 SASI_Mm01_00117130 predicted 806
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_033571
FKBP6 MISSION shRNA Bacterial Glycerol Stock
FK506 binding protein 6, 36kDa
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000111825    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_033571.1-1102s1c1
Sequence:CCGGCCCTGACTGTTACTCCAGGTTCTCGAGAACCTGGAGTAACAGTCAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000111826    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033571.1-850s1c1
Sequence:CCGGCCCTGCAACCATGACATCAATCTCGAGATTGATGTCATGGTTGCAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000111828    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033571.1-399s1c1
Sequence:CCGGCCTGTTTGAGATCGAGCTGATCTCGAGATCAGCTCGATCTCAAACAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000111829    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033571.1-853s1c1
Sequence:CCGGTGCAACCATGACATCAATAATCTCGAGATTATTGATGTCATGGTTGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000111827    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033571.1-244s1c1
Sequence:CCGGCGGCTGATGAAACTTGGAGAACTCGAGTTCTCCAAGTTTCATCAGCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_033571
FKBP6 MISSION shRNA shRNA Plasmid DNA
FK506 binding protein 6, 36kDa
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000111825    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_033571.1-1102s1c1
Sequence:CCGGCCCTGACTGTTACTCCAGGTTCTCGAGAACCTGGAGTAACAGTCAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000111826    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033571.1-850s1c1
Sequence:CCGGCCCTGCAACCATGACATCAATCTCGAGATTGATGTCATGGTTGCAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000111828    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033571.1-399s1c1
Sequence:CCGGCCTGTTTGAGATCGAGCTGATCTCGAGATCAGCTCGATCTCAAACAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000111829    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033571.1-853s1c1
Sequence:CCGGTGCAACCATGACATCAATAATCTCGAGATTATTGATGTCATGGTTGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000111827    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033571.1-244s1c1
Sequence:CCGGCGGCTGATGAAACTTGGAGAACTCGAGTTCTCCAAGTTTCATCAGCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_033571
FKBP6 MISSION shRNA Lentiviral Transduction Particles
FK506 binding protein 6, 36kDa
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000111825    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_033571.1-1102s1c1
Sequence:CCGGCCCTGACTGTTACTCCAGGTTCTCGAGAACCTGGAGTAACAGTCAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000111826    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033571.1-850s1c1
Sequence:CCGGCCCTGCAACCATGACATCAATCTCGAGATTGATGTCATGGTTGCAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000111828    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033571.1-399s1c1
Sequence:CCGGCCTGTTTGAGATCGAGCTGATCTCGAGATCAGCTCGATCTCAAACAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000111829    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033571.1-853s1c1
Sequence:CCGGTGCAACCATGACATCAATAATCTCGAGATTATTGATGTCATGGTTGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000111827    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033571.1-244s1c1
Sequence:CCGGCGGCTGATGAAACTTGGAGAACTCGAGTTCTCCAAGTTTCATCAGCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_003602
FKBP6 MISSION shRNA Bacterial Glycerol Stock
FK506 binding protein 6, 36kDa
Human
11 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000153438    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_003602.2-462s1c1
Sequence:CCGGCTGTTCAAGATTGAGCTGCTTCTCGAGAAGCAGCTCAATCTTGAACAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000152445    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_003602.2-792s1c1
Sequence:CCGGCAGGCTTTGATCATTGACCAACTCGAGTTGGTCAATGATCAAAGCCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000151294    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003602.2-389s1c1
Sequence:CCGGGTTTCTGTTCAAACCGAACTACTCGAGTAGTTCGGTTTGAACAGAAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000151371    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_003602.2-614s1c1
Sequence:CCGGGAATCGTTTCTATGATGCCAACTCGAGTTGGCATCATAGAAACGATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000151638    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_003602.2-1381s1c1
Sequence:CCGGCAACACCAATAGAGATTGCTTCTCGAGAAGCAATCTCTATTGGTGTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000151715    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_003602.2-1268s1c1
Sequence:CCGGCAAGTAGAACACTGCTACTTTCTCGAGAAAGTAGCAGTGTTCTACTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000152716    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_003602.2-609s1c1
Sequence:CCGGCGCCAGAATCGTTTCTATGATCTCGAGATCATAGAAACGATTCTGGCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000158077    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_003602.2-1256s1c1
Sequence:CCGGCGCAGCTACTGACAAGTAGAACTCGAGTTCTACTTGTCAGTAGCTGCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000157579    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_003602.2-983s1c1
Sequence:CCGGGAAAGAAATGTGGCACCGCATCTCGAGATGCGGTGCCACATTTCTTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000157799    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_003602.2-461s1c1
Sequence:CCGGCCTGTTCAAGATTGAGCTGCTCTCGAGAGCAGCTCAATCTTGAACAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000157286    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003602.2-951s1c1
Sequence:CCGGGCTAGCTGTTACAGGGACTATCTCGAGATAGTCCCTGTAACAGCTAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_003602
FKBP6 MISSION shRNA shRNA Plasmid DNA
FK506 binding protein 6, 36kDa
Human
11 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000153438    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_003602.2-462s1c1
Sequence:CCGGCTGTTCAAGATTGAGCTGCTTCTCGAGAAGCAGCTCAATCTTGAACAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000152445    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_003602.2-792s1c1
Sequence:CCGGCAGGCTTTGATCATTGACCAACTCGAGTTGGTCAATGATCAAAGCCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000151294    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003602.2-389s1c1
Sequence:CCGGGTTTCTGTTCAAACCGAACTACTCGAGTAGTTCGGTTTGAACAGAAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000151371    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_003602.2-614s1c1
Sequence:CCGGGAATCGTTTCTATGATGCCAACTCGAGTTGGCATCATAGAAACGATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000151638    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_003602.2-1381s1c1
Sequence:CCGGCAACACCAATAGAGATTGCTTCTCGAGAAGCAATCTCTATTGGTGTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000151715    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_003602.2-1268s1c1
Sequence:CCGGCAAGTAGAACACTGCTACTTTCTCGAGAAAGTAGCAGTGTTCTACTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000152716    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_003602.2-609s1c1
Sequence:CCGGCGCCAGAATCGTTTCTATGATCTCGAGATCATAGAAACGATTCTGGCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000158077    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_003602.2-1256s1c1
Sequence:CCGGCGCAGCTACTGACAAGTAGAACTCGAGTTCTACTTGTCAGTAGCTGCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000157579    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_003602.2-983s1c1
Sequence:CCGGGAAAGAAATGTGGCACCGCATCTCGAGATGCGGTGCCACATTTCTTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000157799    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_003602.2-461s1c1
Sequence:CCGGCCTGTTCAAGATTGAGCTGCTCTCGAGAGCAGCTCAATCTTGAACAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000157286    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003602.2-951s1c1
Sequence:CCGGGCTAGCTGTTACAGGGACTATCTCGAGATAGTCCCTGTAACAGCTAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_003602
FKBP6 MISSION shRNA Lentiviral Transduction Particles
FK506 binding protein 6, 36kDa
Human
11 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000153438    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_003602.2-462s1c1
Sequence:CCGGCTGTTCAAGATTGAGCTGCTTCTCGAGAAGCAGCTCAATCTTGAACAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000152445    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_003602.2-792s1c1
Sequence:CCGGCAGGCTTTGATCATTGACCAACTCGAGTTGGTCAATGATCAAAGCCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000151294    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003602.2-389s1c1
Sequence:CCGGGTTTCTGTTCAAACCGAACTACTCGAGTAGTTCGGTTTGAACAGAAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000151371    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_003602.2-614s1c1
Sequence:CCGGGAATCGTTTCTATGATGCCAACTCGAGTTGGCATCATAGAAACGATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000151638    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_003602.2-1381s1c1
Sequence:CCGGCAACACCAATAGAGATTGCTTCTCGAGAAGCAATCTCTATTGGTGTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000151715    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_003602.2-1268s1c1
Sequence:CCGGCAAGTAGAACACTGCTACTTTCTCGAGAAAGTAGCAGTGTTCTACTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000152716    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_003602.2-609s1c1
Sequence:CCGGCGCCAGAATCGTTTCTATGATCTCGAGATCATAGAAACGATTCTGGCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000158077    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_003602.2-1256s1c1
Sequence:CCGGCGCAGCTACTGACAAGTAGAACTCGAGTTCTACTTGTCAGTAGCTGCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000157579    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_003602.2-983s1c1
Sequence:CCGGGAAAGAAATGTGGCACCGCATCTCGAGATGCGGTGCCACATTTCTTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000157799    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_003602.2-461s1c1
Sequence:CCGGCCTGTTCAAGATTGAGCTGCTCTCGAGAGCAGCTCAATCTTGAACAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000157286    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003602.2-951s1c1
Sequence:CCGGGCTAGCTGTTACAGGGACTATCTCGAGATAGTCCCTGTAACAGCTAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks