EMAIL THIS PAGE TO A FRIEND

FKBP7

FK506 binding protein 7

78 Gene Product Result for
Synonyms: FKBP23 PPIase
UniProtKB ID: Q9Y680, Q4ZG70, Q6V3B2, Q86U65, Q96DA4, Q9Y6B0
Gene ID:
Human(51661) Summary: The protein encoded by this gene belongs to the FKBP-type peptidyl-prolyl cis/trans isomerase (PPIase) family. Members of this family exhibit PPIase activity and function as molecular chaperones. A similar protein in mouse is located in the endoplasmic reticulum and binds calcium. [provided by RefSeq, Jul 2008]
Mouse(14231) FK506 binding protein 7
Rat(295672) FK506 binding protein 7
sheep(101123607) FK506 binding protein 7
naked mole-rat(101703828) FK506 binding protein 7
domestic guinea pig(100725521) FK506 binding protein 7
Zebrafish(368498) FK506 binding protein 7
cow(509422) FK506 binding protein 7
domestic cat(101095119) FK506 binding protein 7
dog(488424) FK506 binding protein 7
chicken(424129) FK506 binding protein 7
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_010222 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_010222 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_010222 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_016105 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_016105 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_016105 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_016105 Rosetta Predictions human pricing
NM_181342 Rosetta Predictions human pricing
NM_001106485 Rosetta Predictions rat pricing
NM_010222 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_016105 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00097186 predicted 245
2 SASI_Hs01_00097187 predicted 229
3 SASI_Hs01_00097188 predicted 230
4 SASI_Hs01_00097189 predicted 246
5 SASI_Hs01_00097190 predicted 253
6 SASI_Hs01_00097191 predicted 245
7 SASI_Hs01_00097192 predicted 250
8 SASI_Hs01_00097193 predicted 480
9 SASI_Hs01_00097194 predicted 947
10 SASI_Hs01_00097195 predicted 524
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_181342 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00370002 predicted 545
2 SASI_Hs02_00370003 predicted 397
3 SASI_Hs02_00370004 predicted 248
4 SASI_Hs02_00370005 predicted 472
5 SASI_Hs02_00370006 predicted 466
6 SASI_Hs02_00370007 predicted 375
7 SASI_Hs02_00370008 predicted 453
8 SASI_Hs02_00370009 predicted 284
9 SASI_Hs02_00370010 predicted 281
10 SASI_Hs02_00370011 predicted 354
11 SASI_Hs01_00024526 predicted 251
12 SASI_Hs01_00024527 predicted 233
13 SASI_Hs01_00024528 predicted 237
14 SASI_Hs01_00024529 predicted 248
15 SASI_Hs01_00024530 predicted 246
16 SASI_Hs01_00024531 predicted 247
17 SASI_Hs01_00024532 predicted 254
18 SASI_Hs01_00024533 predicted 842
19 SASI_Hs01_00024534 predicted 659
20 SASI_Hs01_00024535 predicted 757
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001106485 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00219428 predicted 646
2 SASI_Rn02_00219429 predicted 390
3 SASI_Rn02_00219430 predicted 681
4 SASI_Rn02_00219431 predicted 581
5 SASI_Rn02_00219432 predicted 253
6 SASI_Rn02_00219433 predicted 541
7 SASI_Rn02_00219434 predicted 572
8 SASI_Rn02_00219435 predicted 616
9 SASI_Rn02_00219436 predicted 509
10 SASI_Rn02_00219437 predicted 491
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_010222 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00037313 predicted 477
2 SASI_Mm01_00037314 predicted 482
3 SASI_Mm01_00037315 predicted 516
4 SASI_Mm01_00037316 predicted 484
5 SASI_Mm02_00318070 predicted 195
6 SASI_Mm01_00037318 predicted 436
7 SASI_Mm01_00037320 predicted 373
8 SASI_Mm01_00037321 predicted 235
9 SASI_Mm01_00037322 predicted 406
10 SASI_Mm02_00318071 predicted 524
11 SASI_Mm01_00037317 predicted 453
12 SASI_Mm01_00037319 predicted 489
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_010222
VALIDATED
FKBP7 MISSION shRNA Bacterial Glycerol Stock
FK506 binding protein 7
Mouse
12 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000111820    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010222.1-596s1c1
Sequence:CCGGCCGTGACAAGTCATATCAGAACTCGAGTTCTGATATGACTTGTCACGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000111822    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010222.1-373s1c1
Sequence:CCGGAGGTGATTATACCTCCTTCATCTCGAGATGAAGGAGGTATAATCACCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000111823    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010222.1-486s1c1
Sequence:CCGGCCAAGGAGCATTGAAACATTTCTCGAGAAATGTTTCAATGCTCCTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000111824    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_010222.1-665s1c1
Sequence:CCGGCTTCATTTCTCCTAAGGAATACTCGAGTATTCCTTAGGAGAAATGAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000111821    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_010222.1-441s1c1
Sequence:CCGGGCAACTCTGATGTTTGAGATTCTCGAGAATCTCAAACATCAGAGTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000349955    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_010222.1-203s21c1
Sequence:CCGGAGACTTGCTAAATGCCCATTACTCGAGTAATGGGCATTTAGCAAGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000349890    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_010222.1-306s21c1
Sequence:CCGGGGTGTCGGACATGTCATAAAGCTCGAGCTTTATGACATGTCCGACACCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000312377    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_010222.1-441s21c1
Sequence:CCGGGCAACTCTGATGTTTGAGATTCTCGAGAATCTCAAACATCAGAGTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000313426    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_010222.1-508s21c1
Sequence:CCGGAGCAAATAGACACGGATAATGCTCGAGCATTATCCGTGTCTATTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000313496    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_010222.1-694s21c1
Sequence:CCGGACCAACATGATGAGCTATAAACTCGAGTTTATAGCTCATCATGTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000348712    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_010222.2-534s21c1
Sequence:CCGGTAAGCAAATAGACACGGATAACTCGAGTTATCCGTGTCTATTTGCTTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000348787    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_010222.2-723s21c1
Sequence:CCGGCCAACATGATGAGCTATAAATCTCGAGATTTATAGCTCATCATGTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_010222
VALIDATED
FKBP7 MISSION shRNA shRNA Plasmid DNA
FK506 binding protein 7
Mouse
12 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000111820    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010222.1-596s1c1
Sequence:CCGGCCGTGACAAGTCATATCAGAACTCGAGTTCTGATATGACTTGTCACGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000111822    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010222.1-373s1c1
Sequence:CCGGAGGTGATTATACCTCCTTCATCTCGAGATGAAGGAGGTATAATCACCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000111823    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010222.1-486s1c1
Sequence:CCGGCCAAGGAGCATTGAAACATTTCTCGAGAAATGTTTCAATGCTCCTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000111824    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_010222.1-665s1c1
Sequence:CCGGCTTCATTTCTCCTAAGGAATACTCGAGTATTCCTTAGGAGAAATGAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000111821    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_010222.1-441s1c1
Sequence:CCGGGCAACTCTGATGTTTGAGATTCTCGAGAATCTCAAACATCAGAGTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000349955    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_010222.1-203s21c1
Sequence:CCGGAGACTTGCTAAATGCCCATTACTCGAGTAATGGGCATTTAGCAAGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000349890    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_010222.1-306s21c1
Sequence:CCGGGGTGTCGGACATGTCATAAAGCTCGAGCTTTATGACATGTCCGACACCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000312377    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_010222.1-441s21c1
Sequence:CCGGGCAACTCTGATGTTTGAGATTCTCGAGAATCTCAAACATCAGAGTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000313426    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_010222.1-508s21c1
Sequence:CCGGAGCAAATAGACACGGATAATGCTCGAGCATTATCCGTGTCTATTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000313496    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_010222.1-694s21c1
Sequence:CCGGACCAACATGATGAGCTATAAACTCGAGTTTATAGCTCATCATGTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000348712    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_010222.2-534s21c1
Sequence:CCGGTAAGCAAATAGACACGGATAACTCGAGTTATCCGTGTCTATTTGCTTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000348787    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_010222.2-723s21c1
Sequence:CCGGCCAACATGATGAGCTATAAATCTCGAGATTTATAGCTCATCATGTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_010222
VALIDATED
FKBP7 MISSION shRNA Lentiviral Transduction Particles
FK506 binding protein 7
Mouse
12 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000111820    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010222.1-596s1c1
Sequence:CCGGCCGTGACAAGTCATATCAGAACTCGAGTTCTGATATGACTTGTCACGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000111822    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010222.1-373s1c1
Sequence:CCGGAGGTGATTATACCTCCTTCATCTCGAGATGAAGGAGGTATAATCACCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000111823    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010222.1-486s1c1
Sequence:CCGGCCAAGGAGCATTGAAACATTTCTCGAGAAATGTTTCAATGCTCCTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000111824    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_010222.1-665s1c1
Sequence:CCGGCTTCATTTCTCCTAAGGAATACTCGAGTATTCCTTAGGAGAAATGAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000111821    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_010222.1-441s1c1
Sequence:CCGGGCAACTCTGATGTTTGAGATTCTCGAGAATCTCAAACATCAGAGTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000349955    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_010222.1-203s21c1
Sequence:CCGGAGACTTGCTAAATGCCCATTACTCGAGTAATGGGCATTTAGCAAGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000349890    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_010222.1-306s21c1
Sequence:CCGGGGTGTCGGACATGTCATAAAGCTCGAGCTTTATGACATGTCCGACACCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000312377    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_010222.1-441s21c1
Sequence:CCGGGCAACTCTGATGTTTGAGATTCTCGAGAATCTCAAACATCAGAGTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000313426    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_010222.1-508s21c1
Sequence:CCGGAGCAAATAGACACGGATAATGCTCGAGCATTATCCGTGTCTATTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000313496    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_010222.1-694s21c1
Sequence:CCGGACCAACATGATGAGCTATAAACTCGAGTTTATAGCTCATCATGTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000348712    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_010222.2-534s21c1
Sequence:CCGGTAAGCAAATAGACACGGATAACTCGAGTTATCCGTGTCTATTTGCTTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000348787    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_010222.2-723s21c1
Sequence:CCGGCCAACATGATGAGCTATAAATCTCGAGATTTATAGCTCATCATGTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_016105
VALIDATED
FKBP7 MISSION shRNA Bacterial Glycerol Stock
FK506 binding protein 7
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000053998    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_016105.2-438s1c1
Sequence:CCGGCCCTTCATTTGCATACGGAAACTCGAGTTTCCGTATGCAAATGAAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000053999    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_016105.2-827s1c1
Sequence:CCGGGCTTCATTTCTCCCAAGGAATCTCGAGATTCCTTGGGAGAAATGAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000054001    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_016105.2-649s1c1
Sequence:CCGGCCACGGAGCATTGAGACATTTCTCGAGAAATGTCTCAATGCTCCGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000054002    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_016105.2-595s1c1
Sequence:CCGGCCACCGGATGCTACATTGATTCTCGAGAATCAATGTAGCATCCGGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000054000    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_016105.2-699s1c1
Sequence:CCGGGCTCTCTAAAGCCGAGATAAACTCGAGTTTATCTCGGCTTTAGAGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_016105
VALIDATED
FKBP7 MISSION shRNA shRNA Plasmid DNA
FK506 binding protein 7
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000053998    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_016105.2-438s1c1
Sequence:CCGGCCCTTCATTTGCATACGGAAACTCGAGTTTCCGTATGCAAATGAAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000053999    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_016105.2-827s1c1
Sequence:CCGGGCTTCATTTCTCCCAAGGAATCTCGAGATTCCTTGGGAGAAATGAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000054001    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_016105.2-649s1c1
Sequence:CCGGCCACGGAGCATTGAGACATTTCTCGAGAAATGTCTCAATGCTCCGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000054002    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_016105.2-595s1c1
Sequence:CCGGCCACCGGATGCTACATTGATTCTCGAGAATCAATGTAGCATCCGGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000054000    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_016105.2-699s1c1
Sequence:CCGGGCTCTCTAAAGCCGAGATAAACTCGAGTTTATCTCGGCTTTAGAGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_016105
VALIDATED
FKBP7 MISSION shRNA Lentiviral Transduction Particles
FK506 binding protein 7
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000053998    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_016105.2-438s1c1
Sequence:CCGGCCCTTCATTTGCATACGGAAACTCGAGTTTCCGTATGCAAATGAAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000053999    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_016105.2-827s1c1
Sequence:CCGGGCTTCATTTCTCCCAAGGAATCTCGAGATTCCTTGGGAGAAATGAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000054001    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_016105.2-649s1c1
Sequence:CCGGCCACGGAGCATTGAGACATTTCTCGAGAAATGTCTCAATGCTCCGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000054002    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_016105.2-595s1c1
Sequence:CCGGCCACCGGATGCTACATTGATTCTCGAGAATCAATGTAGCATCCGGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000054000    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_016105.2-699s1c1
Sequence:CCGGGCTCTCTAAAGCCGAGATAAACTCGAGTTTATCTCGGCTTTAGAGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks