EMAIL THIS PAGE TO A FRIEND

FKBP8

FK506 binding protein 8, 38kDa

63 Gene Product Result for
Synonyms: FKBP38 FKBPr38
UniProtKB ID: Q14318, Q53GU3, Q7Z349, Q86YK6
Gene ID:
Human(23770) Summary: The protein encoded by this gene is a member of the immunophilin protein family, which play a role in immunoregulation and basic cellular processes involving protein folding and trafficking. Unlike the other members of the family, this encoded protein does not seem to have PPIase/rotamase activity. It may have a role in neurons associated with memory function. [provided by RefSeq, Jul 2008]
Mouse(14232) FK506 binding protein 8
Rat(290652) FK506 binding protein 8
Zebrafish(393858) FK506 binding protein 8
chicken(420123) FK506 binding protein 8, 38kDa
dog(484819) FK506 binding protein 8, 38kDa
cow(512356) FK506 binding protein 8, 38kDa
Horse(100069569) FK506 binding protein 8, 38kDa
domestic cat(101087821) FK506 binding protein 8, 38kDa
domestic guinea pig(100735438) FK506 binding protein 8, 38kDa
naked mole-rat(101697509) FK506 binding protein 8, 38kDa
Goat(100860953) FK506 binding protein 8, 38kDa
sheep(101108482) FK506 binding protein 8, 38kDa
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_012181 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_012181 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_012181 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_010223 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_010223 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_010223 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU106541 MISSION® esiRNA esiRNA human FKBP8 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_012181 Rosetta Predictions human pricing
NM_001037180 Rosetta Predictions rat pricing
NM_001111066 Rosetta Predictions mouse pricing
NM_010223 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_012181 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00047570 predicted 902
2 SASI_Hs01_00047571 predicted 1520
3 SASI_Hs02_00343795 predicted 1147
4 SASI_Hs01_00047572 predicted 455
5 SASI_Hs01_00047573 predicted 858
6 SASI_Hs01_00047574 predicted 840
7 SASI_Hs01_00047575 predicted 818
8 SASI_Hs01_00047576 predicted 552
9 SASI_Hs01_00047577 predicted 804
10 SASI_Hs01_00047578 predicted 1129
11 SASI_Hs01_00047579 predicted 1329
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001037180 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00084058 predicted 378
2 SASI_Rn01_00084059 predicted 948
3 SASI_Rn01_00084060 predicted 344
4 SASI_Rn01_00084062 predicted 1084
5 SASI_Rn01_00084063 predicted 848
6 SASI_Rn02_00204247 predicted 1425
7 SASI_Rn01_00084064 predicted 1124
8 SASI_Rn01_00084065 predicted 308
9 SASI_Rn01_00084066 predicted 1065
10 SASI_Rn01_00084067 predicted 375
11 SASI_Rn01_00084061 predicted 970
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001111066 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00306305 predicted 1003
2 SASI_Mm02_00306306 predicted 1119
3 SASI_Mm02_00306307 predicted 995
4 SASI_Mm02_00306308 predicted 1012
5 SASI_Mm02_00306309 predicted 1171
6 SASI_Mm02_00306310 predicted 1441
7 SASI_Mm02_00306311 predicted 1424
8 SASI_Mm02_00306312 predicted 1380
9 SASI_Mm02_00306313 predicted 1423
10 SASI_Mm02_00306314 predicted 914
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_010223 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00176630 predicted 1002
2 SASI_Mm01_00176631 predicted 1119
3 SASI_Mm01_00176633 predicted 993
4 SASI_Mm01_00176634 predicted 1003
5 SASI_Mm01_00176635 predicted 1169
6 SASI_Mm01_00176636 predicted 1434
7 SASI_Mm01_00176637 predicted 1422
8 SASI_Mm01_00176638 predicted 1384
9 SASI_Mm01_00176639 predicted 1427
10 SASI_Mm02_00318072 predicted 909
11 SASI_Mm01_00176632 predicted 633
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_012181
VALIDATED
FKBP8 MISSION shRNA Bacterial Glycerol Stock
FK506 binding protein 8, 38kDa
Human
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000422292    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012181.3-178s21c1
Sequence:CCGGAGGACTTCGAGGTACTGGATGCTCGAGCATCCAGTACCTCGAAGTCCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000412515    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012181.3-850s21c1
Sequence:CCGGACCTCGCCATCAAGGCTATCACTCGAGTGATAGCCTTGATGGCGAGGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000413142    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012181.3-626s21c1
Sequence:CCGGCACTGCTGACTCCAAGTACTGCTCGAGCAGTACTTGGAGTCAGCAGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000001100    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: A3
TRC Version: 1 Clone ID:NM_012181.x-199s1c1
Sequence:CCGGGCTGTTGAGGAAGAAGACGCTCTCGAGAGCGTCTTCTTCCTCAACAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000001102    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_012181.x-916s1c1
Sequence:CCGGCAACAAGACGATCCACGCAGACTCGAGTCTGCGTGGATCGTCTTGTTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000001103    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_012181.x-284s1c1
Sequence:CCGGACGTCGCTGGAGAATGGCACACTCGAGTGTGCCATTCTCCAGCGACGTTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000001101    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_012181.x-711s1c1
Sequence:CCGGTGAAGGTGAAGTGTCTGAACACTCGAGTGTTCAGACACTTCACCTTCATTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_012181
VALIDATED
FKBP8 MISSION shRNA shRNA Plasmid DNA
FK506 binding protein 8, 38kDa
Human
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000422292    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012181.3-178s21c1
Sequence:CCGGAGGACTTCGAGGTACTGGATGCTCGAGCATCCAGTACCTCGAAGTCCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000412515    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012181.3-850s21c1
Sequence:CCGGACCTCGCCATCAAGGCTATCACTCGAGTGATAGCCTTGATGGCGAGGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000413142    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012181.3-626s21c1
Sequence:CCGGCACTGCTGACTCCAAGTACTGCTCGAGCAGTACTTGGAGTCAGCAGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000001100    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: A3
TRC Version: 1 Clone ID:NM_012181.x-199s1c1
Sequence:CCGGGCTGTTGAGGAAGAAGACGCTCTCGAGAGCGTCTTCTTCCTCAACAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000001102    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_012181.x-916s1c1
Sequence:CCGGCAACAAGACGATCCACGCAGACTCGAGTCTGCGTGGATCGTCTTGTTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000001103    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_012181.x-284s1c1
Sequence:CCGGACGTCGCTGGAGAATGGCACACTCGAGTGTGCCATTCTCCAGCGACGTTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000001101    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_012181.x-711s1c1
Sequence:CCGGTGAAGGTGAAGTGTCTGAACACTCGAGTGTTCAGACACTTCACCTTCATTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_012181
VALIDATED
FKBP8 MISSION shRNA Lentiviral Transduction Particles
FK506 binding protein 8, 38kDa
Human
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000422292    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012181.3-178s21c1
Sequence:CCGGAGGACTTCGAGGTACTGGATGCTCGAGCATCCAGTACCTCGAAGTCCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000412515    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012181.3-850s21c1
Sequence:CCGGACCTCGCCATCAAGGCTATCACTCGAGTGATAGCCTTGATGGCGAGGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000413142    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012181.3-626s21c1
Sequence:CCGGCACTGCTGACTCCAAGTACTGCTCGAGCAGTACTTGGAGTCAGCAGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000001100    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: A3
TRC Version: 1 Clone ID:NM_012181.x-199s1c1
Sequence:CCGGGCTGTTGAGGAAGAAGACGCTCTCGAGAGCGTCTTCTTCCTCAACAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000001102    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_012181.x-916s1c1
Sequence:CCGGCAACAAGACGATCCACGCAGACTCGAGTCTGCGTGGATCGTCTTGTTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000001103    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_012181.x-284s1c1
Sequence:CCGGACGTCGCTGGAGAATGGCACACTCGAGTGTGCCATTCTCCAGCGACGTTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000001101    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_012181.x-711s1c1
Sequence:CCGGTGAAGGTGAAGTGTCTGAACACTCGAGTGTTCAGACACTTCACCTTCATTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_010223
VALIDATED
FKBP8 MISSION shRNA Bacterial Glycerol Stock
FK506 binding protein 8, 38kDa
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000280135    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_010223.2-1429s21c1
Sequence:CCGGGCAAGGATTGAGGGTCAAATACTCGAGTATTTGACCCTCAATCCTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000280192    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010223.2-1122s21c1
Sequence:CCGGGCTCTCAAAGCTGGTAAAGAACTCGAGTTCTTTACCAGCTTTGAGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000280191    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010223.2-894s21c1
Sequence:CCGGGCTGAAGGTCAAGTGTCTGAACTCGAGTTCAGACACTTGACCTTCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000297774    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010223.2-1044s21c1
Sequence:CCGGAGGTGAATATAGTGAGGCCATCTCGAGATGGCCTCACTATATTCACCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000012378    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010223.1-1199s1c1
Sequence:CCGGGCAAGGATTGAGGGTCAAATACTCGAGTATTTGACCCTCAATCCTTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000012379    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010223.1-664s1c1
Sequence:CCGGGCTGAAGGTCAAGTGTCTGAACTCGAGTTCAGACACTTGACCTTCAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000012381    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010223.1-946s1c1
Sequence:CCGGGTACCGAAAGATGCTAGGCAACTCGAGTTGCCTAGCATCTTTCGGTACTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000012382    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010223.1-814s1c1
Sequence:CCGGAGGTGAATATAGTGAGGCCATCTCGAGATGGCCTCACTATATTCACCTTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000012380    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010223.1-892s1c1
Sequence:CCGGGCTCTCAAAGCTGGTAAAGAACTCGAGTTCTTTACCAGCTTTGAGAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_010223
VALIDATED
FKBP8 MISSION shRNA shRNA Plasmid DNA
FK506 binding protein 8, 38kDa
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000280135    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_010223.2-1429s21c1
Sequence:CCGGGCAAGGATTGAGGGTCAAATACTCGAGTATTTGACCCTCAATCCTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000280192    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010223.2-1122s21c1
Sequence:CCGGGCTCTCAAAGCTGGTAAAGAACTCGAGTTCTTTACCAGCTTTGAGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000280191    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010223.2-894s21c1
Sequence:CCGGGCTGAAGGTCAAGTGTCTGAACTCGAGTTCAGACACTTGACCTTCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000297774    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010223.2-1044s21c1
Sequence:CCGGAGGTGAATATAGTGAGGCCATCTCGAGATGGCCTCACTATATTCACCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000012378    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010223.1-1199s1c1
Sequence:CCGGGCAAGGATTGAGGGTCAAATACTCGAGTATTTGACCCTCAATCCTTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000012379    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010223.1-664s1c1
Sequence:CCGGGCTGAAGGTCAAGTGTCTGAACTCGAGTTCAGACACTTGACCTTCAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000012381    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010223.1-946s1c1
Sequence:CCGGGTACCGAAAGATGCTAGGCAACTCGAGTTGCCTAGCATCTTTCGGTACTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000012382    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010223.1-814s1c1
Sequence:CCGGAGGTGAATATAGTGAGGCCATCTCGAGATGGCCTCACTATATTCACCTTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000012380    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010223.1-892s1c1
Sequence:CCGGGCTCTCAAAGCTGGTAAAGAACTCGAGTTCTTTACCAGCTTTGAGAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_010223
VALIDATED
FKBP8 MISSION shRNA Lentiviral Transduction Particles
FK506 binding protein 8, 38kDa
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000280135    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_010223.2-1429s21c1
Sequence:CCGGGCAAGGATTGAGGGTCAAATACTCGAGTATTTGACCCTCAATCCTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000280192    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010223.2-1122s21c1
Sequence:CCGGGCTCTCAAAGCTGGTAAAGAACTCGAGTTCTTTACCAGCTTTGAGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000280191    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010223.2-894s21c1
Sequence:CCGGGCTGAAGGTCAAGTGTCTGAACTCGAGTTCAGACACTTGACCTTCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000297774    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010223.2-1044s21c1
Sequence:CCGGAGGTGAATATAGTGAGGCCATCTCGAGATGGCCTCACTATATTCACCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000012378    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010223.1-1199s1c1
Sequence:CCGGGCAAGGATTGAGGGTCAAATACTCGAGTATTTGACCCTCAATCCTTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000012379    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010223.1-664s1c1
Sequence:CCGGGCTGAAGGTCAAGTGTCTGAACTCGAGTTCAGACACTTGACCTTCAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000012381    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010223.1-946s1c1
Sequence:CCGGGTACCGAAAGATGCTAGGCAACTCGAGTTGCCTAGCATCTTTCGGTACTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000012382    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010223.1-814s1c1
Sequence:CCGGAGGTGAATATAGTGAGGCCATCTCGAGATGGCCTCACTATATTCACCTTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000012380    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010223.1-892s1c1
Sequence:CCGGGCTCTCAAAGCTGGTAAAGAACTCGAGTTCTTTACCAGCTTTGAGAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks