EMAIL THIS PAGE TO A FRIEND

FKBP9

FK506 binding protein 9, 63 kDa

Synonyms: FKBP60 FKBP63 PPIase
Gene ID:
Mouse(27055) FK506 binding protein 9
Rat(297123) FK506 binding protein 9
sheep(101120487) FK506 binding protein 9, 63 kDa
naked mole-rat(101718120) FK506 binding protein 9, 63 kDa
domestic guinea pig(100724655) FK506 binding protein 9, 63 kDa
Zebrafish(445126) FK506 binding protein 9
chicken(395652) FK506 binding protein 9, 63 kDa
cow(534182) FK506 binding protein 9, 63 kDa
domestic cat(101091007) FK506 binding protein 9, 63 kDa
dog(475276) FK506 binding protein 9, 63 kDa
58 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_007270 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_007270 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_007270 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_012056 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_012056 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_012056 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_007270 Rosetta Predictions human pricing
NM_001007646 Rosetta Predictions rat pricing
NM_012056 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_007270 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00051790 predicted 1936
2 SASI_Hs02_00343317 predicted 1818
3 SASI_Hs01_00051792 predicted 421
4 SASI_Hs01_00051793 predicted 573
5 SASI_Hs01_00051794 predicted 462
6 SASI_Hs01_00051796 predicted 1668
7 SASI_Hs01_00051797 predicted 1733
8 SASI_Hs02_00343318 predicted 1521
9 SASI_Hs02_00343319 predicted 528
10 SASI_Hs02_00343320 predicted 1430
11 SASI_Hs01_00051788 predicted 741
12 SASI_Hs01_00051789 predicted 1824
13 SASI_Hs01_00051791 predicted 1059
14 SASI_Hs01_00051795 predicted 1728
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001007646 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00111660 predicted 1072
2 SASI_Rn01_00111661 predicted 1920
3 SASI_Rn01_00111662 predicted 1030
4 SASI_Rn01_00111663 predicted 1898
5 SASI_Rn01_00111664 predicted 269
6 SASI_Rn01_00111665 predicted 1811
7 SASI_Rn01_00111666 predicted 592
8 SASI_Rn01_00111667 predicted 559
9 SASI_Rn01_00111668 predicted 1815
10 SASI_Rn01_00111669 predicted 1301
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_012056 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00033418 predicted 1731
2 SASI_Mm01_00033419 predicted 589
3 SASI_Mm01_00033421 predicted 1062
4 SASI_Mm02_00322033 predicted 1105
5 SASI_Mm01_00033420 predicted 627
6 SASI_Mm02_00322034 predicted 1951
7 SASI_Mm01_00033422 predicted 437
8 SASI_Mm01_00033423 predicted 914
9 SASI_Mm01_00033425 predicted 1834
10 SASI_Mm02_00322035 predicted 988
11 SASI_Mm01_00033417 predicted 510
12 SASI_Mm01_00033424 predicted 1828
13 SASI_Mm01_00033426 predicted 1666
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_007270
VALIDATED
FKBP9 MISSION shRNA Bacterial Glycerol Stock
FK506 binding protein 9, 63 kDa
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000054190    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 1 Clone ID:NM_007270.2-1286s1c1
Sequence:CCGGGCTGAGTAAGAAGGGAGATTACTCGAGTAATCTCCCTTCTTACTCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000054189    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 1 Clone ID:NM_007270.2-480s1c1
Sequence:CCGGGCCTACGGAAATGAAGGAGTTCTCGAGAACTCCTTCATTTCCGTAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000054188    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 1 Clone ID:NM_007270.2-1041s1c1
Sequence:CCGGCGCACGTTTGACACGTACATTCTCGAGAATGTACGTGTCAAACGTGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000054191    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 1 Clone ID:NM_007270.2-446s1c1
Sequence:CCGGCGAGAGACGTTTCGTGAAGATCTCGAGATCTTCACGAAACGTCTCTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000054192    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 1 Clone ID:NM_007270.2-366s1c1
Sequence:CCGGGACTCCACTTTCAATGTGTTTCTCGAGAAACACATTGAAAGTGGAGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000291309    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: A549
TRC Version: 2 Clone ID:NM_007270.3-1333s21c1
Sequence:CCGGGCTGAGTAAGAAGGGAGATTACTCGAGTAATCTCCCTTCTTACTCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000291347    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007270.3-413s21c1
Sequence:CCGGGACTCCACTTTCAATGTGTTTCTCGAGAAACACATTGAAAGTGGAGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000291346    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 2 Clone ID:NM_007270.3-1088s21c1
Sequence:CCGGCGCACGTTTGACACGTACATTCTCGAGAATGTACGTGTCAAACGTGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000291345    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: A549
TRC Version: 2 Clone ID:NM_007270.3-527s21c1
Sequence:CCGGGCCTACGGAAATGAAGGAGTTCTCGAGAACTCCTTCATTTCCGTAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000291344    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007270.3-493s21c1
Sequence:CCGGCGAGAGACGTTTCGTGAAGATCTCGAGATCTTCACGAAACGTCTCTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_007270
VALIDATED
FKBP9 MISSION shRNA shRNA Plasmid DNA
FK506 binding protein 9, 63 kDa
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000054190    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 1 Clone ID:NM_007270.2-1286s1c1
Sequence:CCGGGCTGAGTAAGAAGGGAGATTACTCGAGTAATCTCCCTTCTTACTCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000054189    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 1 Clone ID:NM_007270.2-480s1c1
Sequence:CCGGGCCTACGGAAATGAAGGAGTTCTCGAGAACTCCTTCATTTCCGTAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000054188    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 1 Clone ID:NM_007270.2-1041s1c1
Sequence:CCGGCGCACGTTTGACACGTACATTCTCGAGAATGTACGTGTCAAACGTGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000054191    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 1 Clone ID:NM_007270.2-446s1c1
Sequence:CCGGCGAGAGACGTTTCGTGAAGATCTCGAGATCTTCACGAAACGTCTCTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000054192    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 1 Clone ID:NM_007270.2-366s1c1
Sequence:CCGGGACTCCACTTTCAATGTGTTTCTCGAGAAACACATTGAAAGTGGAGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000291309    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: A549
TRC Version: 2 Clone ID:NM_007270.3-1333s21c1
Sequence:CCGGGCTGAGTAAGAAGGGAGATTACTCGAGTAATCTCCCTTCTTACTCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000291347    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007270.3-413s21c1
Sequence:CCGGGACTCCACTTTCAATGTGTTTCTCGAGAAACACATTGAAAGTGGAGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000291346    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 2 Clone ID:NM_007270.3-1088s21c1
Sequence:CCGGCGCACGTTTGACACGTACATTCTCGAGAATGTACGTGTCAAACGTGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000291345    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: A549
TRC Version: 2 Clone ID:NM_007270.3-527s21c1
Sequence:CCGGGCCTACGGAAATGAAGGAGTTCTCGAGAACTCCTTCATTTCCGTAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000291344    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007270.3-493s21c1
Sequence:CCGGCGAGAGACGTTTCGTGAAGATCTCGAGATCTTCACGAAACGTCTCTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_007270
VALIDATED
FKBP9 MISSION shRNA Lentiviral Transduction Particles
FK506 binding protein 9, 63 kDa
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000054190    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 1 Clone ID:NM_007270.2-1286s1c1
Sequence:CCGGGCTGAGTAAGAAGGGAGATTACTCGAGTAATCTCCCTTCTTACTCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000054189    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 1 Clone ID:NM_007270.2-480s1c1
Sequence:CCGGGCCTACGGAAATGAAGGAGTTCTCGAGAACTCCTTCATTTCCGTAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000054188    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 1 Clone ID:NM_007270.2-1041s1c1
Sequence:CCGGCGCACGTTTGACACGTACATTCTCGAGAATGTACGTGTCAAACGTGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000054191    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 1 Clone ID:NM_007270.2-446s1c1
Sequence:CCGGCGAGAGACGTTTCGTGAAGATCTCGAGATCTTCACGAAACGTCTCTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000054192    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 1 Clone ID:NM_007270.2-366s1c1
Sequence:CCGGGACTCCACTTTCAATGTGTTTCTCGAGAAACACATTGAAAGTGGAGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000291309    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: A549
TRC Version: 2 Clone ID:NM_007270.3-1333s21c1
Sequence:CCGGGCTGAGTAAGAAGGGAGATTACTCGAGTAATCTCCCTTCTTACTCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000291347    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007270.3-413s21c1
Sequence:CCGGGACTCCACTTTCAATGTGTTTCTCGAGAAACACATTGAAAGTGGAGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000291346    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 2 Clone ID:NM_007270.3-1088s21c1
Sequence:CCGGCGCACGTTTGACACGTACATTCTCGAGAATGTACGTGTCAAACGTGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000291345    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: A549
TRC Version: 2 Clone ID:NM_007270.3-527s21c1
Sequence:CCGGGCCTACGGAAATGAAGGAGTTCTCGAGAACTCCTTCATTTCCGTAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000291344    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007270.3-493s21c1
Sequence:CCGGCGAGAGACGTTTCGTGAAGATCTCGAGATCTTCACGAAACGTCTCTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_012056
VALIDATED
FKBP9 MISSION shRNA Bacterial Glycerol Stock
FK506 binding protein 9, 63 kDa
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000111850    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.86 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_012056.1-2185s1c1
Sequence:CCGGCCAGGTGTCTACCTAAAGAAACTCGAGTTTCTTTAGGTAGACACCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000111853    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012056.1-1032s1c1
Sequence:CCGGCCACACCTTTGACACATACATCTCGAGATGTATGTGTCAAAGGTGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000111854    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012056.1-1236s1c1
Sequence:CCGGCATCAGCATCACTTCCCACTACTCGAGTAGTGGGAAGTGATGCTGATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000111852    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_012056.1-473s1c1
Sequence:CCGGCCTACGGAAGTGAAGGAGTTTCTCGAGAAACTCCTTCACTTCCGTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000111851    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_012056.1-892s1c1
Sequence:CCGGCCCAAGGATACCATTTCCATTCTCGAGAATGGAAATGGTATCCTTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000332876    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012056.2-914s21c1
Sequence:CCGGCCCAAGGATACCATTTCCATTCTCGAGAATGGAAATGGTATCCTTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000332801    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_012056.2-2206s21c1
Sequence:CCGGCCAGGTGTCTACCTAAAGAAACTCGAGTTTCTTTAGGTAGACACCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000332806    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012056.2-1054s21c1
Sequence:CCGGCCACACCTTTGACACATACATCTCGAGATGTATGTGTCAAAGGTGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000332800    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012056.2-495s21c1
Sequence:CCGGCCTACGGAAGTGAAGGAGTTTCTCGAGAAACTCCTTCACTTCCGTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000332879    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012056.2-1258s21c1
Sequence:CCGGCATCAGCATCACTTCCCACTACTCGAGTAGTGGGAAGTGATGCTGATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_012056
VALIDATED
FKBP9 MISSION shRNA shRNA Plasmid DNA
FK506 binding protein 9, 63 kDa
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000111850    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.86 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_012056.1-2185s1c1
Sequence:CCGGCCAGGTGTCTACCTAAAGAAACTCGAGTTTCTTTAGGTAGACACCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000111853    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012056.1-1032s1c1
Sequence:CCGGCCACACCTTTGACACATACATCTCGAGATGTATGTGTCAAAGGTGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000111854    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012056.1-1236s1c1
Sequence:CCGGCATCAGCATCACTTCCCACTACTCGAGTAGTGGGAAGTGATGCTGATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000111852    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_012056.1-473s1c1
Sequence:CCGGCCTACGGAAGTGAAGGAGTTTCTCGAGAAACTCCTTCACTTCCGTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000111851    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_012056.1-892s1c1
Sequence:CCGGCCCAAGGATACCATTTCCATTCTCGAGAATGGAAATGGTATCCTTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000332876    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012056.2-914s21c1
Sequence:CCGGCCCAAGGATACCATTTCCATTCTCGAGAATGGAAATGGTATCCTTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000332801    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_012056.2-2206s21c1
Sequence:CCGGCCAGGTGTCTACCTAAAGAAACTCGAGTTTCTTTAGGTAGACACCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000332806    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012056.2-1054s21c1
Sequence:CCGGCCACACCTTTGACACATACATCTCGAGATGTATGTGTCAAAGGTGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000332800    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012056.2-495s21c1
Sequence:CCGGCCTACGGAAGTGAAGGAGTTTCTCGAGAAACTCCTTCACTTCCGTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000332879    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012056.2-1258s21c1
Sequence:CCGGCATCAGCATCACTTCCCACTACTCGAGTAGTGGGAAGTGATGCTGATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_012056
VALIDATED
FKBP9 MISSION shRNA Lentiviral Transduction Particles
FK506 binding protein 9, 63 kDa
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000111850    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.86 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_012056.1-2185s1c1
Sequence:CCGGCCAGGTGTCTACCTAAAGAAACTCGAGTTTCTTTAGGTAGACACCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000111853    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012056.1-1032s1c1
Sequence:CCGGCCACACCTTTGACACATACATCTCGAGATGTATGTGTCAAAGGTGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000111854    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012056.1-1236s1c1
Sequence:CCGGCATCAGCATCACTTCCCACTACTCGAGTAGTGGGAAGTGATGCTGATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000111852    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_012056.1-473s1c1
Sequence:CCGGCCTACGGAAGTGAAGGAGTTTCTCGAGAAACTCCTTCACTTCCGTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000111851    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_012056.1-892s1c1
Sequence:CCGGCCCAAGGATACCATTTCCATTCTCGAGAATGGAAATGGTATCCTTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000332876    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012056.2-914s21c1
Sequence:CCGGCCCAAGGATACCATTTCCATTCTCGAGAATGGAAATGGTATCCTTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000332801    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_012056.2-2206s21c1
Sequence:CCGGCCAGGTGTCTACCTAAAGAAACTCGAGTTTCTTTAGGTAGACACCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000332806    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012056.2-1054s21c1
Sequence:CCGGCCACACCTTTGACACATACATCTCGAGATGTATGTGTCAAAGGTGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000332800    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012056.2-495s21c1
Sequence:CCGGCCTACGGAAGTGAAGGAGTTTCTCGAGAAACTCCTTCACTTCCGTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000332879    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012056.2-1258s21c1
Sequence:CCGGCATCAGCATCACTTCCCACTACTCGAGTAGTGGGAAGTGATGCTGATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks