EMAIL THIS PAGE TO A FRIEND

FKBP9L

FK506 binding protein 9-like

22 Gene Product Result for
Species: Human FKBP9L(360132)
UniProtKB ID: Q75LS8, B2R7H1
Gene ID:
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_182827 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_182827 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_182827 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_182827 Rosetta Predictions human pricing
NR_003949 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_182827 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00226579 predicted 971
2 SASI_Hs01_00226580 predicted 946
3 SASI_Hs01_00226581 predicted 977
4 SASI_Hs01_00226582 predicted 885
5 SASI_Hs01_00226583 predicted 822
6 SASI_Hs01_00226584 predicted 753
7 SASI_Hs01_00226585 predicted 860
8 SASI_Hs01_00226586 predicted 700
9 SASI_Hs01_00226587 predicted 767
10 SASI_Hs01_00226588 predicted 553
siRNA
PRODUCT # siRNA Type ? SPECIES
NR_003949 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00380694 predicted 703
2 SASI_Hs02_00380695 predicted 946
3 SASI_Hs02_00380696 predicted 931
4 SASI_Hs02_00380697 predicted 965
5 SASI_Hs02_00380698 predicted 2133
6 SASI_Hs02_00380699 predicted 806
7 SASI_Hs02_00380700 predicted 689
8 SASI_Hs02_00380701 predicted 750
9 SASI_Hs02_00380702 predicted 536
10 SASI_Hs02_00380703 predicted 443
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_182827
FKBP9L MISSION shRNA Bacterial Glycerol Stock
FK506 binding protein 9-like
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000056318    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_182827.1-556s1c1
Sequence:CCGGGCCGTATTAGTGTTTGACATTCTCGAGAATGTCAAACACTAATACGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000056322    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_182827.1-768s1c1
Sequence:CCGGGCTGATTGTGAAGAATATGTTCTCGAGAACATATTCTTCACAATCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000056319    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_182827.1-763s1c1
Sequence:CCGGGCTGAGCTGATTGTGAAGAATCTCGAGATTCTTCACAATCAGCTCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000056320    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_182827.1-690s1c1
Sequence:CCGGCCTGGAAGAGTTCTCAGAGTACTCGAGTACTCTGAGAACTCTTCCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000056321    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_182827.1-826s1c1
Sequence:CCGGGCTGAGGAATTTAAACTCAAACTCGAGTTTGAGTTTAAATTCCTCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_182827
FKBP9L MISSION shRNA shRNA Plasmid DNA
FK506 binding protein 9-like
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000056318    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_182827.1-556s1c1
Sequence:CCGGGCCGTATTAGTGTTTGACATTCTCGAGAATGTCAAACACTAATACGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000056322    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_182827.1-768s1c1
Sequence:CCGGGCTGATTGTGAAGAATATGTTCTCGAGAACATATTCTTCACAATCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000056319    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_182827.1-763s1c1
Sequence:CCGGGCTGAGCTGATTGTGAAGAATCTCGAGATTCTTCACAATCAGCTCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000056320    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_182827.1-690s1c1
Sequence:CCGGCCTGGAAGAGTTCTCAGAGTACTCGAGTACTCTGAGAACTCTTCCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000056321    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_182827.1-826s1c1
Sequence:CCGGGCTGAGGAATTTAAACTCAAACTCGAGTTTGAGTTTAAATTCCTCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_182827
FKBP9L MISSION shRNA Lentiviral Transduction Particles
FK506 binding protein 9-like
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000056318    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_182827.1-556s1c1
Sequence:CCGGGCCGTATTAGTGTTTGACATTCTCGAGAATGTCAAACACTAATACGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000056322    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_182827.1-768s1c1
Sequence:CCGGGCTGATTGTGAAGAATATGTTCTCGAGAACATATTCTTCACAATCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000056319    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_182827.1-763s1c1
Sequence:CCGGGCTGAGCTGATTGTGAAGAATCTCGAGATTCTTCACAATCAGCTCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000056320    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_182827.1-690s1c1
Sequence:CCGGCCTGGAAGAGTTCTCAGAGTACTCGAGTACTCTGAGAACTCTTCCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000056321    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_182827.1-826s1c1
Sequence:CCGGGCTGAGGAATTTAAACTCAAACTCGAGTTTGAGTTTAAATTCCTCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks