EMAIL THIS PAGE TO A FRIEND

FKBPL

FK506 binding protein like

57 Gene Product Result for
Synonyms: DIR1 NG7 WISP39
UniProtKB ID: Q9UIM3, A8K5V3, B0UYX8, Q9H5G3
Gene ID:
Human(63943) Summary: The protein encoded by this gene has similarity to the immunophilin protein family, which play a role in immunoregulation and basic cellular processes involving protein folding and trafficking. The encoded protein is thought to have a potential role in the induced radioresistance. Also it appears to have some involvement in the control of the cell cycle. [provided by RefSeq, Jul 2008]
Mouse(56299) FK506 binding protein-like
Rat(406168) FK506 binding protein-like
cow(513929) FK506 binding protein like
domestic cat(101095099) FK506 binding protein like
dog(481724) FK506 binding protein like
domestic guinea pig(100714227) FK506 binding protein like
naked mole-rat(101715442) FK506 binding protein like
sheep(101113368) FK506 binding protein like
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_022110 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_022110 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_022110 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_019873 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_019873 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_019873 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_022110 Rosetta Predictions human pricing
NM_001002818 Rosetta Predictions rat pricing
NM_019873 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_022110 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00194303 predicted 490
2 SASI_Hs01_00194305 predicted 340
3 SASI_Hs01_00194306 predicted 430
4 SASI_Hs01_00194308 predicted 533
5 SASI_Hs01_00194310 predicted 350
6 SASI_Hs02_00355500 predicted 445
7 SASI_Hs02_00355501 predicted 357
8 SASI_Hs02_00355502 predicted 492
9 SASI_Hs01_00194304 predicted 564
10 SASI_Hs01_00194307 predicted 973
11 SASI_Hs01_00194309 predicted 577
12 SASI_Hs01_00194311 predicted 1024
13 SASI_Hs01_00194312 predicted 746
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001002818 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00080691 predicted 941
2 SASI_Rn02_00198002 predicted 209
3 SASI_Rn01_00080692 predicted 485
4 SASI_Rn01_00080693 predicted 713
5 SASI_Rn01_00080694 predicted 347
6 SASI_Rn01_00080695 predicted 208
7 SASI_Rn01_00080696 predicted 970
8 SASI_Rn01_00080697 predicted 750
9 SASI_Rn01_00080698 predicted 977
10 SASI_Rn01_00080699 predicted 735
11 SASI_Rn01_00080700 predicted 707
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_019873 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00114301 predicted 242
2 SASI_Mm01_00114302 predicted 825
3 SASI_Mm02_00325178 predicted 690
4 SASI_Mm01_00114303 predicted 449
5 SASI_Mm01_00114304 predicted 309
6 SASI_Mm01_00114305 predicted 830
7 SASI_Mm01_00114306 predicted 243
8 SASI_Mm01_00114307 predicted 368
9 SASI_Mm01_00114308 predicted 636
10 SASI_Mm01_00114309 predicted 923
11 SASI_Mm01_00114310 predicted 858
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_022110
VALIDATED
FKBPL MISSION shRNA Bacterial Glycerol Stock
FK506 binding protein like
Human
14 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000131145    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_022110.3-343s1c1
Sequence:CCGGCTTCGGGAGAACCTTGATTCACTCGAGTGAATCAAGGTTCTCCCGAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000131088    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022110.3-403s1c1
Sequence:CCGGGAAACGCTTGAGCTGGAAGTACTCGAGTACTTCCAGCTCAAGCGTTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000130935    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_022110.3-923s1c1
Sequence:CCGGCAGAACTATTTCGAGCTGGGACTCGAGTCCCAGCTCGAAATAGTTCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000130807    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_022110.3-490s1c1
Sequence:CCGGGAAGGAGACTCTCATAAGTCTCTCGAGAGACTTATGAGAGTCTCCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000129414    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022110.3-436s1c1
Sequence:CCGGGCCAGCCAAATTCTAGAGCATCTCGAGATGCTCTAGAATTTGGCTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000128489    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_022110.3-578s1c1
Sequence:CCGGGCTTTGTCAAGAAGATCGTAACTCGAGTTACGATCTTCTTGACAAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000127617    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022110.3-1118s1c1
Sequence:CCGGCTGGCCATTTAAAGGCCTTATCTCGAGATAAGGCCTTTAAATGGCCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000130720    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_022110.3-484s1c1
Sequence:CCGGGAACTTGAAGGAGACTCTCATCTCGAGATGAGAGTCTCCTTCAAGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000130840    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: 293T/17
TRC Version: 1.5 Clone ID:NM_022110.3-744s1c1
Sequence:CCGGGCTCATAGAGAAATGCTTGGACTCGAGTCCAAGCATTTCTCTATGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000281940    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022110.3-688s21c1
Sequence:CCGGGGCTGGACAGAGCTAACTATGCTCGAGCATAGTTAGCTCTGTCCAGCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000272346    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022110.3-979s21c1
Sequence:CCGGCTTCGGCTGCTCCTGACTTTACTCGAGTAAAGTCAGGAGCAGCCGAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000272294    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022110.3-1022s21c1
Sequence:CCGGGAACTGTCCTTCATGCCAATCCTCGAGGATTGGCATGAAGGACAGTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000281888    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022110.3-610s21c1
Sequence:CCGGGGCTTGGACAAACCCAAACTACTCGAGTAGTTTGGGTTTGTCCAAGCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000272295    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022110.3-744s21c1
Sequence:CCGGGCTCATAGAGAAATGCTTGGACTCGAGTCCAAGCATTTCTCTATGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_022110
VALIDATED
FKBPL MISSION shRNA shRNA Plasmid DNA
FK506 binding protein like
Human
14 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000131145    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_022110.3-343s1c1
Sequence:CCGGCTTCGGGAGAACCTTGATTCACTCGAGTGAATCAAGGTTCTCCCGAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000131088    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022110.3-403s1c1
Sequence:CCGGGAAACGCTTGAGCTGGAAGTACTCGAGTACTTCCAGCTCAAGCGTTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000130935    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_022110.3-923s1c1
Sequence:CCGGCAGAACTATTTCGAGCTGGGACTCGAGTCCCAGCTCGAAATAGTTCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000130807    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_022110.3-490s1c1
Sequence:CCGGGAAGGAGACTCTCATAAGTCTCTCGAGAGACTTATGAGAGTCTCCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000129414    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022110.3-436s1c1
Sequence:CCGGGCCAGCCAAATTCTAGAGCATCTCGAGATGCTCTAGAATTTGGCTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000128489    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_022110.3-578s1c1
Sequence:CCGGGCTTTGTCAAGAAGATCGTAACTCGAGTTACGATCTTCTTGACAAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000127617    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022110.3-1118s1c1
Sequence:CCGGCTGGCCATTTAAAGGCCTTATCTCGAGATAAGGCCTTTAAATGGCCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000130720    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_022110.3-484s1c1
Sequence:CCGGGAACTTGAAGGAGACTCTCATCTCGAGATGAGAGTCTCCTTCAAGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000130840    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: 293T/17
TRC Version: 1.5 Clone ID:NM_022110.3-744s1c1
Sequence:CCGGGCTCATAGAGAAATGCTTGGACTCGAGTCCAAGCATTTCTCTATGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000281940    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022110.3-688s21c1
Sequence:CCGGGGCTGGACAGAGCTAACTATGCTCGAGCATAGTTAGCTCTGTCCAGCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000272346    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022110.3-979s21c1
Sequence:CCGGCTTCGGCTGCTCCTGACTTTACTCGAGTAAAGTCAGGAGCAGCCGAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000272294    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022110.3-1022s21c1
Sequence:CCGGGAACTGTCCTTCATGCCAATCCTCGAGGATTGGCATGAAGGACAGTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000281888    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022110.3-610s21c1
Sequence:CCGGGGCTTGGACAAACCCAAACTACTCGAGTAGTTTGGGTTTGTCCAAGCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000272295    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022110.3-744s21c1
Sequence:CCGGGCTCATAGAGAAATGCTTGGACTCGAGTCCAAGCATTTCTCTATGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_022110
VALIDATED
FKBPL MISSION shRNA Lentiviral Transduction Particles
FK506 binding protein like
Human
14 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000131145    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_022110.3-343s1c1
Sequence:CCGGCTTCGGGAGAACCTTGATTCACTCGAGTGAATCAAGGTTCTCCCGAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000131088    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022110.3-403s1c1
Sequence:CCGGGAAACGCTTGAGCTGGAAGTACTCGAGTACTTCCAGCTCAAGCGTTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000130935    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_022110.3-923s1c1
Sequence:CCGGCAGAACTATTTCGAGCTGGGACTCGAGTCCCAGCTCGAAATAGTTCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000130807    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_022110.3-490s1c1
Sequence:CCGGGAAGGAGACTCTCATAAGTCTCTCGAGAGACTTATGAGAGTCTCCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000129414    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022110.3-436s1c1
Sequence:CCGGGCCAGCCAAATTCTAGAGCATCTCGAGATGCTCTAGAATTTGGCTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000128489    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_022110.3-578s1c1
Sequence:CCGGGCTTTGTCAAGAAGATCGTAACTCGAGTTACGATCTTCTTGACAAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000127617    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022110.3-1118s1c1
Sequence:CCGGCTGGCCATTTAAAGGCCTTATCTCGAGATAAGGCCTTTAAATGGCCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000130720    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_022110.3-484s1c1
Sequence:CCGGGAACTTGAAGGAGACTCTCATCTCGAGATGAGAGTCTCCTTCAAGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000130840    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: 293T/17
TRC Version: 1.5 Clone ID:NM_022110.3-744s1c1
Sequence:CCGGGCTCATAGAGAAATGCTTGGACTCGAGTCCAAGCATTTCTCTATGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000281940    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022110.3-688s21c1
Sequence:CCGGGGCTGGACAGAGCTAACTATGCTCGAGCATAGTTAGCTCTGTCCAGCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000272346    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022110.3-979s21c1
Sequence:CCGGCTTCGGCTGCTCCTGACTTTACTCGAGTAAAGTCAGGAGCAGCCGAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000272294    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022110.3-1022s21c1
Sequence:CCGGGAACTGTCCTTCATGCCAATCCTCGAGGATTGGCATGAAGGACAGTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000281888    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022110.3-610s21c1
Sequence:CCGGGGCTTGGACAAACCCAAACTACTCGAGTAGTTTGGGTTTGTCCAAGCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000272295    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022110.3-744s21c1
Sequence:CCGGGCTCATAGAGAAATGCTTGGACTCGAGTCCAAGCATTTCTCTATGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_019873
VALIDATED
FKBPL MISSION shRNA Bacterial Glycerol Stock
FK506 binding protein like
Mouse
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000201186    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_019873.2-363s1c1
Sequence:CCGGGATCTTTGGTACTGTCCTGATCTCGAGATCAGGACAGTACCAAAGATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000190943    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_019873.2-452s1c1
Sequence:CCGGCCAAGTGTTGGCTTTGGGATTCTCGAGAATCCCAAAGCCAACACTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000248834    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_019873.2-152s21c1
Sequence:CCGGGAACGCCCAGCAAATCTTAAACTCGAGTTTAAGATTTGCTGGGCGTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000248831    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019873.2-431s21c1
Sequence:CCGGACCCAAGCTAGGCTCCAAATGCTCGAGCATTTGGAGCCTAGCTTGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000217853    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_019873.2-929s1c1
Sequence:CCGGGGGCCATTTAAAGGCCTTATACTCGAGTATAAGGCCTTTAAATGGCCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000248832    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019873.2-239s21c1
Sequence:CCGGACCGGATCCAGCCAATCAAATCTCGAGATTTGATTGGCTGGATCCGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000248830    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_019873.2-824s21c1
Sequence:CCGGTCCCGAACGAACTACCCTTTACTCGAGTAAAGGGTAGTTCGTTCGGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000248833    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019873.2-929s21c1
Sequence:CCGGGGGCCATTTAAAGGCCTTATACTCGAGTATAAGGCCTTTAAATGGCCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_019873
VALIDATED
FKBPL MISSION shRNA shRNA Plasmid DNA
FK506 binding protein like
Mouse
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000201186    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_019873.2-363s1c1
Sequence:CCGGGATCTTTGGTACTGTCCTGATCTCGAGATCAGGACAGTACCAAAGATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000190943    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_019873.2-452s1c1
Sequence:CCGGCCAAGTGTTGGCTTTGGGATTCTCGAGAATCCCAAAGCCAACACTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000248834    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_019873.2-152s21c1
Sequence:CCGGGAACGCCCAGCAAATCTTAAACTCGAGTTTAAGATTTGCTGGGCGTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000248831    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019873.2-431s21c1
Sequence:CCGGACCCAAGCTAGGCTCCAAATGCTCGAGCATTTGGAGCCTAGCTTGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000217853    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_019873.2-929s1c1
Sequence:CCGGGGGCCATTTAAAGGCCTTATACTCGAGTATAAGGCCTTTAAATGGCCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000248832    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019873.2-239s21c1
Sequence:CCGGACCGGATCCAGCCAATCAAATCTCGAGATTTGATTGGCTGGATCCGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000248830    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_019873.2-824s21c1
Sequence:CCGGTCCCGAACGAACTACCCTTTACTCGAGTAAAGGGTAGTTCGTTCGGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000248833    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019873.2-929s21c1
Sequence:CCGGGGGCCATTTAAAGGCCTTATACTCGAGTATAAGGCCTTTAAATGGCCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_019873
VALIDATED
FKBPL MISSION shRNA Lentiviral Transduction Particles
FK506 binding protein like
Mouse
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000201186    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_019873.2-363s1c1
Sequence:CCGGGATCTTTGGTACTGTCCTGATCTCGAGATCAGGACAGTACCAAAGATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000190943    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_019873.2-452s1c1
Sequence:CCGGCCAAGTGTTGGCTTTGGGATTCTCGAGAATCCCAAAGCCAACACTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000248834    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_019873.2-152s21c1
Sequence:CCGGGAACGCCCAGCAAATCTTAAACTCGAGTTTAAGATTTGCTGGGCGTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000248831    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019873.2-431s21c1
Sequence:CCGGACCCAAGCTAGGCTCCAAATGCTCGAGCATTTGGAGCCTAGCTTGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000217853    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_019873.2-929s1c1
Sequence:CCGGGGGCCATTTAAAGGCCTTATACTCGAGTATAAGGCCTTTAAATGGCCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000248832    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019873.2-239s21c1
Sequence:CCGGACCGGATCCAGCCAATCAAATCTCGAGATTTGATTGGCTGGATCCGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000248830    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_019873.2-824s21c1
Sequence:CCGGTCCCGAACGAACTACCCTTTACTCGAGTAAAGGGTAGTTCGTTCGGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000248833    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019873.2-929s21c1
Sequence:CCGGGGGCCATTTAAAGGCCTTATACTCGAGTATAAGGCCTTTAAATGGCCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks