EMAIL THIS PAGE TO A FRIEND

FKRP

fukutin related protein

Synonyms: LGMD2I MDC1C MDDGA5 MDDGB5 MDDGC5
UniProtKB ID: Q9H9S5, A8K5G7
Gene ID:
Human(79147) Summary: This gene encodes a protein which is targeted to the medial Golgi apparatus and is necessary for posttranslational modification of dystroglycan. Mutations in this gene have been associated with congenital muscular dystrophy, mental retardation, and cerebellar cysts. Several alternatively spliced transcript variants of this gene have been described, but the full-length nature of some of these variants has not been determined. [provided by RefSeq, Oct 2008]
Mouse(243853) fukutin related protein
Rat(308390) fukutin related protein
Zebrafish(571426) fukutin related protein
chicken(431512) fukutin related protein
cow(539701) fukutin related protein
domestic cat(101099604) fukutin related protein
dog(484426) fukutin related protein
sheep(101117098) fukutin related protein
Domestic Rabbit(100356414) fukutin related protein
naked mole-rat(101720645) fukutin related protein
domestic guinea pig(100717803) fukutin related protein
61 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_173430 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_173430 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_173430 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_024301 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_024301 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_024301 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EMU036701 MISSION® esiRNA esiRNA targeting mouse Fkrp (esiRNA1) mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001039885 Rosetta Predictions human pricing
NM_024301 Rosetta Predictions human pricing
NM_001025678 Rosetta Predictions rat pricing
NM_173430 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001039885 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00118997 predicted 1999
2 SASI_Hs01_00118998 predicted 881
3 SASI_Hs01_00118999 predicted 1572
4 SASI_Hs01_00119000 predicted 2008
5 SASI_Hs01_00119001 predicted 2001
6 SASI_Hs01_00119002 predicted 2114
7 SASI_Hs01_00119003 predicted 1670
8 SASI_Hs01_00119004 predicted 2126
9 SASI_Hs01_00119005 predicted 1041
10 SASI_Hs02_00308697 predicted 1368
11 SASI_Hs01_00118996 predicted 678
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_024301 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00203745 predicted 1784
2 SASI_Hs01_00203746 predicted 662
3 SASI_Hs01_00203747 predicted 1354
4 SASI_Hs01_00203748 predicted 1785
5 SASI_Hs01_00203749 predicted 1789
6 SASI_Hs01_00203750 predicted 1897
7 SASI_Hs01_00203751 predicted 1453
8 SASI_Hs01_00203752 predicted 1905
9 SASI_Hs01_00203753 predicted 821
10 SASI_Hs01_00203754 predicted 1149
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001025678 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00068643 predicted 1284
2 SASI_Rn01_00068645 predicted 500
3 SASI_Rn01_00068646 predicted 1923
4 SASI_Rn01_00068647 predicted 217
5 SASI_Rn01_00068648 predicted 1145
6 SASI_Rn01_00068649 predicted 2061
7 SASI_Rn01_00068650 predicted 786
8 SASI_Rn02_00203283 predicted 236
9 SASI_Rn01_00068651 predicted 232
10 SASI_Rn01_00068652 predicted 1993
11 SASI_Rn01_00068644 predicted 319
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_173430 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00165585 predicted 2018
2 SASI_Mm01_00165586 predicted 1975
3 SASI_Mm01_00165587 predicted 2049
4 SASI_Mm01_00165588 predicted 1331
5 SASI_Mm01_00165589 predicted 1997
6 SASI_Mm01_00165590 predicted 826
7 SASI_Mm01_00165591 predicted 508
8 SASI_Mm01_00165592 predicted 2109
9 SASI_Mm01_00165593 predicted 1224
10 SASI_Mm02_00345313 predicted 620
11 SASI_Mm01_00165584 predicted 324
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_173430
VALIDATED
FKRP MISSION shRNA Bacterial Glycerol Stock
fukutin related protein
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000436786    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173430.2-1294s21c1
Sequence:CCGGTAGTGGATGAACGCGGCTTTGCTCGAGCAAAGCCGCGTTCATCCACTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000427142    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173430.2-1209s21c1
Sequence:CCGGCCTTGGGACTACGACGTAGATCTCGAGATCTACGTCGTAGTCCCAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000426397    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173430.2-494s21c1
Sequence:CCGGCTACGTAGCCACCGAGTTTGTCTCGAGACAAACTCGGTGGCTACGTAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000430932    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_173430.2-1906s21c1
Sequence:CCGGGCATAGTCTCTGCCCTATATTCTCGAGAATATAGGGCAGAGACTATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000125398    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_173430.1-162s1c1
Sequence:CCGGCATCCTCAACCTCCTAGTCTTCTCGAGAAGACTAGGAGGTTGAGGATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000125394    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.82 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_173430.1-2009s1c1
Sequence:CCGGCCAGTCTGTTTCATTTGAGATCTCGAGATCTCAAATGAAACAGACTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000125395    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_173430.1-310s1c1
Sequence:CCGGCCAGAGCTAGTGGATTCCTTTCTCGAGAAAGGAATCCACTAGCTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000125397    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173430.1-1473s1c1
Sequence:CCGGCCTGCCCTTTGCGGGTTTCATCTCGAGATGAAACCCGCAAAGGGCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000125396    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_173430.1-1320s1c1
Sequence:CCGGCGACTTCTTCCGAGTACAGTACTCGAGTACTGTACTCGGAAGAAGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_173430
VALIDATED
FKRP MISSION shRNA shRNA Plasmid DNA
fukutin related protein
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000436786    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173430.2-1294s21c1
Sequence:CCGGTAGTGGATGAACGCGGCTTTGCTCGAGCAAAGCCGCGTTCATCCACTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000427142    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173430.2-1209s21c1
Sequence:CCGGCCTTGGGACTACGACGTAGATCTCGAGATCTACGTCGTAGTCCCAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000426397    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173430.2-494s21c1
Sequence:CCGGCTACGTAGCCACCGAGTTTGTCTCGAGACAAACTCGGTGGCTACGTAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000430932    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_173430.2-1906s21c1
Sequence:CCGGGCATAGTCTCTGCCCTATATTCTCGAGAATATAGGGCAGAGACTATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000125398    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_173430.1-162s1c1
Sequence:CCGGCATCCTCAACCTCCTAGTCTTCTCGAGAAGACTAGGAGGTTGAGGATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000125394    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.82 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_173430.1-2009s1c1
Sequence:CCGGCCAGTCTGTTTCATTTGAGATCTCGAGATCTCAAATGAAACAGACTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000125395    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_173430.1-310s1c1
Sequence:CCGGCCAGAGCTAGTGGATTCCTTTCTCGAGAAAGGAATCCACTAGCTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000125397    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173430.1-1473s1c1
Sequence:CCGGCCTGCCCTTTGCGGGTTTCATCTCGAGATGAAACCCGCAAAGGGCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000125396    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_173430.1-1320s1c1
Sequence:CCGGCGACTTCTTCCGAGTACAGTACTCGAGTACTGTACTCGGAAGAAGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_173430
VALIDATED
FKRP MISSION shRNA Lentiviral Transduction Particles
fukutin related protein
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000436786    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173430.2-1294s21c1
Sequence:CCGGTAGTGGATGAACGCGGCTTTGCTCGAGCAAAGCCGCGTTCATCCACTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000427142    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173430.2-1209s21c1
Sequence:CCGGCCTTGGGACTACGACGTAGATCTCGAGATCTACGTCGTAGTCCCAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000426397    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173430.2-494s21c1
Sequence:CCGGCTACGTAGCCACCGAGTTTGTCTCGAGACAAACTCGGTGGCTACGTAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000430932    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_173430.2-1906s21c1
Sequence:CCGGGCATAGTCTCTGCCCTATATTCTCGAGAATATAGGGCAGAGACTATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000125398    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_173430.1-162s1c1
Sequence:CCGGCATCCTCAACCTCCTAGTCTTCTCGAGAAGACTAGGAGGTTGAGGATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000125394    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.82 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_173430.1-2009s1c1
Sequence:CCGGCCAGTCTGTTTCATTTGAGATCTCGAGATCTCAAATGAAACAGACTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000125395    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_173430.1-310s1c1
Sequence:CCGGCCAGAGCTAGTGGATTCCTTTCTCGAGAAAGGAATCCACTAGCTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000125397    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173430.1-1473s1c1
Sequence:CCGGCCTGCCCTTTGCGGGTTTCATCTCGAGATGAAACCCGCAAAGGGCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000125396    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_173430.1-1320s1c1
Sequence:CCGGCGACTTCTTCCGAGTACAGTACTCGAGTACTGTACTCGGAAGAAGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_024301
VALIDATED
FKRP MISSION shRNA Bacterial Glycerol Stock
fukutin related protein
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000082848    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.76 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_024301.2-2519s1c1
Sequence:CCGGGCTACTCTTAACTGTTCTATTCTCGAGAATAGAACAGTTAAGAGTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000082852    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_024301.2-1497s1c1
Sequence:CCGGCGTGCAGTACAGCGAAAGCAACTCGAGTTGCTTTCGCTGTACTGCACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000082851    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024301.2-652s1c1
Sequence:CCGGACCGAGTTTGTGGCCCTAGTACTCGAGTACTAGGGCCACAAACTCGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000082849    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_024301.2-1503s1c1
Sequence:CCGGGTACAGCGAAAGCAACCACTTCTCGAGAAGTGGTTGCTTTCGCTGTACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000082850    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_024301.2-442s1c1
Sequence:CCGGGTGCGGGAGTTCGAGGCATTTCTCGAGAAATGCCTCGAACTCCCGCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_024301
VALIDATED
FKRP MISSION shRNA shRNA Plasmid DNA
fukutin related protein
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000082848    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.76 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_024301.2-2519s1c1
Sequence:CCGGGCTACTCTTAACTGTTCTATTCTCGAGAATAGAACAGTTAAGAGTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000082852    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_024301.2-1497s1c1
Sequence:CCGGCGTGCAGTACAGCGAAAGCAACTCGAGTTGCTTTCGCTGTACTGCACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000082851    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024301.2-652s1c1
Sequence:CCGGACCGAGTTTGTGGCCCTAGTACTCGAGTACTAGGGCCACAAACTCGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000082849    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_024301.2-1503s1c1
Sequence:CCGGGTACAGCGAAAGCAACCACTTCTCGAGAAGTGGTTGCTTTCGCTGTACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000082850    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_024301.2-442s1c1
Sequence:CCGGGTGCGGGAGTTCGAGGCATTTCTCGAGAAATGCCTCGAACTCCCGCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_024301
VALIDATED
FKRP MISSION shRNA Lentiviral Transduction Particles
fukutin related protein
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000082848    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.76 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_024301.2-2519s1c1
Sequence:CCGGGCTACTCTTAACTGTTCTATTCTCGAGAATAGAACAGTTAAGAGTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000082852    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_024301.2-1497s1c1
Sequence:CCGGCGTGCAGTACAGCGAAAGCAACTCGAGTTGCTTTCGCTGTACTGCACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000082851    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024301.2-652s1c1
Sequence:CCGGACCGAGTTTGTGGCCCTAGTACTCGAGTACTAGGGCCACAAACTCGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000082849    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_024301.2-1503s1c1
Sequence:CCGGGTACAGCGAAAGCAACCACTTCTCGAGAAGTGGTTGCTTTCGCTGTACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000082850    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_024301.2-442s1c1
Sequence:CCGGGTGCGGGAGTTCGAGGCATTTCTCGAGAAATGCCTCGAACTCCCGCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks