EMAIL THIS PAGE TO A FRIEND

FKSG2

16 Gene Product Result for
Species: Human FKSG2(59347)
Gene ID:
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_021631 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_021631 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_021631 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_021631 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_021631 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00219602 predicted 195
2 SASI_Hs01_00219603 predicted 199
3 SASI_Hs01_00219604 predicted 279
4 SASI_Hs01_00219607 predicted 281
5 SASI_Hs01_00219608 predicted 234
6 SASI_Hs01_00219610 predicted 225
7 SASI_Hs01_00219611 predicted 224
8 SASI_Hs02_00354980 predicted 231
9 SASI_Hs02_00354981 predicted 219
10 SASI_Hs02_00354982 predicted 227
11 SASI_Hs01_00219605 predicted 205
12 SASI_Hs01_00219606 predicted 205
13 SASI_Hs01_00219609 predicted 205
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_021631
FKSG2 MISSION shRNA Bacterial Glycerol Stock
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000157331    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021631.1-225s1c1
Sequence:CCGGCCATCACTTGCAGGAAAGCATCTCGAGATGCTTTCCTGCAAGTGATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000154257    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021631.1-307s1c1
Sequence:CCGGCTTGAAGAACAGAGACCAGAACTCGAGTTCTGGTCTCTGTTCTTCAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000150822    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021631.1-320s1c1
Sequence:CCGGGACCAGAAAGAGTGAAACTTTCTCGAGAAAGTTTCACTCTTTCTGGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000154025    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_021631.1-316s1c1
Sequence:CCGGCAGAGACCAGAAAGAGTGAAACTCGAGTTTCACTCTTTCTGGTCTCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000153801    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_021631.1-123s1c1
Sequence:CCGGGAACACTGATGACTCACTCATCTCGAGATGAGTGAGTCATCAGTGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000153243    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021631.1-146s1c1
Sequence:CCGGGCAGAAATTCCTCCTCTGAAACTCGAGTTTCAGAGGAGGAATTTCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000153282    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021631.1-133s1c1
Sequence:CCGGGACTCACTCATTGGCAGAAATCTCGAGATTTCTGCCAATGAGTGAGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000153931    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_021631.1-221s1c1
Sequence:CCGGCAAACCATCACTTGCAGGAAACTCGAGTTTCCTGCAAGTGATGGTTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_021631
FKSG2 MISSION shRNA shRNA Plasmid DNA
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000157331    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021631.1-225s1c1
Sequence:CCGGCCATCACTTGCAGGAAAGCATCTCGAGATGCTTTCCTGCAAGTGATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000154257    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021631.1-307s1c1
Sequence:CCGGCTTGAAGAACAGAGACCAGAACTCGAGTTCTGGTCTCTGTTCTTCAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000150822    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021631.1-320s1c1
Sequence:CCGGGACCAGAAAGAGTGAAACTTTCTCGAGAAAGTTTCACTCTTTCTGGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000154025    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_021631.1-316s1c1
Sequence:CCGGCAGAGACCAGAAAGAGTGAAACTCGAGTTTCACTCTTTCTGGTCTCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000153801    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_021631.1-123s1c1
Sequence:CCGGGAACACTGATGACTCACTCATCTCGAGATGAGTGAGTCATCAGTGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000153243    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021631.1-146s1c1
Sequence:CCGGGCAGAAATTCCTCCTCTGAAACTCGAGTTTCAGAGGAGGAATTTCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000153282    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021631.1-133s1c1
Sequence:CCGGGACTCACTCATTGGCAGAAATCTCGAGATTTCTGCCAATGAGTGAGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000153931    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_021631.1-221s1c1
Sequence:CCGGCAAACCATCACTTGCAGGAAACTCGAGTTTCCTGCAAGTGATGGTTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_021631
FKSG2 MISSION shRNA Lentiviral Transduction Particles
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000157331    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021631.1-225s1c1
Sequence:CCGGCCATCACTTGCAGGAAAGCATCTCGAGATGCTTTCCTGCAAGTGATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000154257    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021631.1-307s1c1
Sequence:CCGGCTTGAAGAACAGAGACCAGAACTCGAGTTCTGGTCTCTGTTCTTCAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000150822    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021631.1-320s1c1
Sequence:CCGGGACCAGAAAGAGTGAAACTTTCTCGAGAAAGTTTCACTCTTTCTGGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000154025    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_021631.1-316s1c1
Sequence:CCGGCAGAGACCAGAAAGAGTGAAACTCGAGTTTCACTCTTTCTGGTCTCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000153801    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_021631.1-123s1c1
Sequence:CCGGGAACACTGATGACTCACTCATCTCGAGATGAGTGAGTCATCAGTGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000153243    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021631.1-146s1c1
Sequence:CCGGGCAGAAATTCCTCCTCTGAAACTCGAGTTTCAGAGGAGGAATTTCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000153282    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021631.1-133s1c1
Sequence:CCGGGACTCACTCATTGGCAGAAATCTCGAGATTTCTGCCAATGAGTGAGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000153931    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_021631.1-221s1c1
Sequence:CCGGCAAACCATCACTTGCAGGAAACTCGAGTTTCCTGCAAGTGATGGTTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks