EMAIL THIS PAGE TO A FRIEND

FKTN

fukutin

121 Gene Product Result for
Synonyms: CMD1X FCMD LGMD2M MDDGA4 MDDGB4 MDDGC4
UniProtKB ID: O75072, B4DUX9, J3KP13, Q3MIJ1, Q96TE1, Q9P295
Gene ID:
Human(2218) Summary: The protein encoded by this gene is a putative transmembrane protein that is localized to the cis-Golgi compartment, where it may be involved in the glycosylation of alpha-dystroglycan in skeletal muscle. The encoded protein is thought to be a glycosyltransferase and could play a role in brain development. Defects in this gene are a cause of Fukuyama-type congenital muscular dystrophy (FCMD), Walker-Warburg syndrome (WWS), limb-girdle muscular dystrophy type 2M (LGMD2M), and dilated cardiomyopathy type 1X (CMD1X). Alternatively spliced transcript variants have been found for this gene. [provided by RefSeq, Nov 2010]
Mouse(246179) fukutin
Rat(362520) fukutin
chicken(427303) fukutin
dog(481652) fukutin
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_139309 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_139309 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_139309 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_006731 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_006731 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_006731 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001079802 Rosetta Predictions human pricing
NM_006731 Rosetta Predictions human pricing
NM_001108667 Rosetta Predictions rat pricing
NM_139309 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001079802 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00313710 predicted 349
2 SASI_Hs02_00313711 predicted 869
3 SASI_Hs02_00313712 predicted 462
4 SASI_Hs02_00313713 predicted 1587
5 SASI_Hs02_00313714 predicted 827
6 SASI_Hs02_00313715 predicted 834
7 SASI_Hs02_00313716 predicted 622
8 SASI_Hs02_00313717 predicted 1049
9 SASI_Hs02_00313718 predicted 1152
10 SASI_Hs02_00313719 predicted 1091
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_006731 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00231042 predicted 261
2 SASI_Hs01_00231043 predicted 770
3 SASI_Hs01_00231044 predicted 374
4 SASI_Hs02_00342169 predicted 1496
5 SASI_Hs01_00231047 predicted 732
6 SASI_Hs01_00231046 predicted 743
7 SASI_Hs01_00231048 predicted 530
8 SASI_Hs01_00231049 predicted 956
9 SASI_Hs01_00231050 predicted 1061
10 SASI_Hs02_00342170 predicted 997
11 SASI_Hs01_00231041 predicted 346
12 SASI_Hs01_00231045 predicted 775
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001108667 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00240885 predicted 1257
2 SASI_Rn02_00240886 predicted 1062
3 SASI_Rn02_00240887 predicted 1668
4 SASI_Rn02_00240888 predicted 908
5 SASI_Rn02_00240889 predicted 495
6 SASI_Rn02_00240890 predicted 1614
7 SASI_Rn02_00240891 predicted 712
8 SASI_Rn02_00240892 predicted 460
9 SASI_Rn02_00240893 predicted 333
10 SASI_Rn02_00240894 predicted 974
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_139309 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00340011 predicted 723
2 SASI_Mm02_00340012 predicted 913
3 SASI_Mm02_00340013 predicted 1458
4 SASI_Mm02_00340014 predicted 756
5 SASI_Mm02_00340015 predicted 238
6 SASI_Mm02_00340016 predicted 887
7 SASI_Mm02_00340017 predicted 1080
8 SASI_Mm02_00340018 predicted 945
9 SASI_Mm02_00340019 predicted 528
10 SASI_Mm02_00340020 predicted 1009
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_139309
FKTN MISSION shRNA Bacterial Glycerol Stock
fukutin
Mouse
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000175490    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_139309.2-2838s1c1
Sequence:CCGGCCTTGGAATGTGTAGTCACTACTCGAGTAGTGACTACACATTCCAAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000174300    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_139309.2-1040s1c1
Sequence:CCGGCGGTATTATTCCTTACAGCAACTCGAGTTGCTGTAAGGAATAATACCGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000194045    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_139309.2-2197s1c1
Sequence:CCGGGCAGTGGTACTTGCTGATAAACTCGAGTTTATCAGCAAGTACCACTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000193660    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_139309.2-1376s1c1
Sequence:CCGGCAACTATGGTAAGACCTGGAACTCGAGTTCCAGGTCTTACCATAGTTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000314265    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_139309.4-2837s21c1
Sequence:CCGGCCTTGGAATGTGTAGTCACTACTCGAGTAGTGACTACACATTCCAAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000314335    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_139309.4-2196s21c1
Sequence:CCGGGCAGTGGTACTTGCTGATAAACTCGAGTTTATCAGCAAGTACCACTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000314334    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_139309.4-1039s21c1
Sequence:CCGGCGGTATTATTCCTTACAGCAACTCGAGTTGCTGTAAGGAATAATACCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000350236    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_139309.4-1375s21c1
Sequence:CCGGCAACTATGGTAAGACCTGGAACTCGAGTTCCAGGTCTTACCATAGTTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_139309
FKTN MISSION shRNA shRNA Plasmid DNA
fukutin
Mouse
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000175490    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_139309.2-2838s1c1
Sequence:CCGGCCTTGGAATGTGTAGTCACTACTCGAGTAGTGACTACACATTCCAAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000174300    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_139309.2-1040s1c1
Sequence:CCGGCGGTATTATTCCTTACAGCAACTCGAGTTGCTGTAAGGAATAATACCGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000194045    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_139309.2-2197s1c1
Sequence:CCGGGCAGTGGTACTTGCTGATAAACTCGAGTTTATCAGCAAGTACCACTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000193660    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_139309.2-1376s1c1
Sequence:CCGGCAACTATGGTAAGACCTGGAACTCGAGTTCCAGGTCTTACCATAGTTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000314265    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_139309.4-2837s21c1
Sequence:CCGGCCTTGGAATGTGTAGTCACTACTCGAGTAGTGACTACACATTCCAAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000314335    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_139309.4-2196s21c1
Sequence:CCGGGCAGTGGTACTTGCTGATAAACTCGAGTTTATCAGCAAGTACCACTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000314334    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_139309.4-1039s21c1
Sequence:CCGGCGGTATTATTCCTTACAGCAACTCGAGTTGCTGTAAGGAATAATACCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000350236    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_139309.4-1375s21c1
Sequence:CCGGCAACTATGGTAAGACCTGGAACTCGAGTTCCAGGTCTTACCATAGTTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_139309
FKTN MISSION shRNA Lentiviral Transduction Particles
fukutin
Mouse
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000175490    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_139309.2-2838s1c1
Sequence:CCGGCCTTGGAATGTGTAGTCACTACTCGAGTAGTGACTACACATTCCAAGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000174300    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_139309.2-1040s1c1
Sequence:CCGGCGGTATTATTCCTTACAGCAACTCGAGTTGCTGTAAGGAATAATACCGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000194045    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_139309.2-2197s1c1
Sequence:CCGGGCAGTGGTACTTGCTGATAAACTCGAGTTTATCAGCAAGTACCACTGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000193660    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_139309.2-1376s1c1
Sequence:CCGGCAACTATGGTAAGACCTGGAACTCGAGTTCCAGGTCTTACCATAGTTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000314265    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_139309.4-2837s21c1
Sequence:CCGGCCTTGGAATGTGTAGTCACTACTCGAGTAGTGACTACACATTCCAAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000314335    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_139309.4-2196s21c1
Sequence:CCGGGCAGTGGTACTTGCTGATAAACTCGAGTTTATCAGCAAGTACCACTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000314334    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_139309.4-1039s21c1
Sequence:CCGGCGGTATTATTCCTTACAGCAACTCGAGTTGCTGTAAGGAATAATACCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000350236    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_139309.4-1375s21c1
Sequence:CCGGCAACTATGGTAAGACCTGGAACTCGAGTTCCAGGTCTTACCATAGTTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_006731
VALIDATED
FKTN MISSION shRNA Bacterial Glycerol Stock
fukutin
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000063763    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: A549
TRC Version: 1 Clone ID:NM_006731.1-619s1c1
Sequence:CCGGGCGATCCACTTGGTAGTCTTTCTCGAGAAAGACTACCAAGTGGATCGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000063764    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006731.1-1356s1c1
Sequence:CCGGCCTCGAATACATTGAAGCCAACTCGAGTTGGCTTCAATGTATTCGAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000063766    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: A549
TRC Version: 1 Clone ID:NM_006731.1-814s1c1
Sequence:CCGGCCAATGCACTTTGTAGAAGAACTCGAGTTCTTCTACAAAGTGCATTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000063767    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: A549
TRC Version: 1 Clone ID:NM_006731.1-340s1c1
Sequence:CCGGCCTTTGATACTGGAATTGATTCTCGAGAATCAATTCCAGTATCAAAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000063765    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: A549
TRC Version: 1 Clone ID:NM_006731.1-174s1c1
Sequence:CCGGGCTGTTTCAGTTGTACTACTACTCGAGTAGTAGTACAACTGAAACAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000435236    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_006731.2-1972s21c1
Sequence:CCGGTTGTGGAGTCTGAGTTAATATCTCGAGATATTAACTCAGACTCCACAATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000416772    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006731.2-1038s21c1
Sequence:CCGGGGTATCGACAATGCAACATTACTCGAGTAATGTTGCATTGTCGATACCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000419646    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_006731.2-1721s21c1
Sequence:CCGGGCCTAGATGAATGAGACAAATCTCGAGATTTGTCTCATTCATCTAGGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000423778    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006731.2-1459s21c1
Sequence:CCGGCAATGGAATCTGGCCTATTTCCTCGAGGAAATAGGCCAGATTCCATTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000432583    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006731.2-735s21c1
Sequence:CCGGAGTTACAGTTTGGTCGTTATCCTCGAGGATAACGACCAAACTGTAACTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_006731
VALIDATED
FKTN MISSION shRNA shRNA Plasmid DNA
fukutin
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000063763    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: A549
TRC Version: 1 Clone ID:NM_006731.1-619s1c1
Sequence:CCGGGCGATCCACTTGGTAGTCTTTCTCGAGAAAGACTACCAAGTGGATCGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000063764    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006731.1-1356s1c1
Sequence:CCGGCCTCGAATACATTGAAGCCAACTCGAGTTGGCTTCAATGTATTCGAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000063766    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: A549
TRC Version: 1 Clone ID:NM_006731.1-814s1c1
Sequence:CCGGCCAATGCACTTTGTAGAAGAACTCGAGTTCTTCTACAAAGTGCATTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000063767    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: A549
TRC Version: 1 Clone ID:NM_006731.1-340s1c1
Sequence:CCGGCCTTTGATACTGGAATTGATTCTCGAGAATCAATTCCAGTATCAAAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000063765    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: A549
TRC Version: 1 Clone ID:NM_006731.1-174s1c1
Sequence:CCGGGCTGTTTCAGTTGTACTACTACTCGAGTAGTAGTACAACTGAAACAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000435236    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_006731.2-1972s21c1
Sequence:CCGGTTGTGGAGTCTGAGTTAATATCTCGAGATATTAACTCAGACTCCACAATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000416772    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006731.2-1038s21c1
Sequence:CCGGGGTATCGACAATGCAACATTACTCGAGTAATGTTGCATTGTCGATACCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000419646    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_006731.2-1721s21c1
Sequence:CCGGGCCTAGATGAATGAGACAAATCTCGAGATTTGTCTCATTCATCTAGGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000423778    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006731.2-1459s21c1
Sequence:CCGGCAATGGAATCTGGCCTATTTCCTCGAGGAAATAGGCCAGATTCCATTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000432583    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006731.2-735s21c1
Sequence:CCGGAGTTACAGTTTGGTCGTTATCCTCGAGGATAACGACCAAACTGTAACTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_006731
VALIDATED
FKTN MISSION shRNA Lentiviral Transduction Particles
fukutin
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000063763    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: A549
TRC Version: 1 Clone ID:NM_006731.1-619s1c1
Sequence:CCGGGCGATCCACTTGGTAGTCTTTCTCGAGAAAGACTACCAAGTGGATCGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000063764    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006731.1-1356s1c1
Sequence:CCGGCCTCGAATACATTGAAGCCAACTCGAGTTGGCTTCAATGTATTCGAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000063766    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: A549
TRC Version: 1 Clone ID:NM_006731.1-814s1c1
Sequence:CCGGCCAATGCACTTTGTAGAAGAACTCGAGTTCTTCTACAAAGTGCATTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000063767    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: A549
TRC Version: 1 Clone ID:NM_006731.1-340s1c1
Sequence:CCGGCCTTTGATACTGGAATTGATTCTCGAGAATCAATTCCAGTATCAAAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000063765    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: A549
TRC Version: 1 Clone ID:NM_006731.1-174s1c1
Sequence:CCGGGCTGTTTCAGTTGTACTACTACTCGAGTAGTAGTACAACTGAAACAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000435236    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_006731.2-1972s21c1
Sequence:CCGGTTGTGGAGTCTGAGTTAATATCTCGAGATATTAACTCAGACTCCACAATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000416772    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006731.2-1038s21c1
Sequence:CCGGGGTATCGACAATGCAACATTACTCGAGTAATGTTGCATTGTCGATACCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000419646    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_006731.2-1721s21c1
Sequence:CCGGGCCTAGATGAATGAGACAAATCTCGAGATTTGTCTCATTCATCTAGGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000423778    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006731.2-1459s21c1
Sequence:CCGGCAATGGAATCTGGCCTATTTCCTCGAGGAAATAGGCCAGATTCCATTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000432583    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006731.2-735s21c1
Sequence:CCGGAGTTACAGTTTGGTCGTTATCCTCGAGGATAACGACCAAACTGTAACTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)