EMAIL THIS PAGE TO A FRIEND

FLAD1

flavin adenine dinucleotide synthetase 1

69 Gene Product Result for
Synonyms: FAD1 FADS RP11-307C12.7
Gene ID:
Human(80308) Summary: This gene encodes the enzyme that catalyzes adenylation of flavin mononucleotide (FMN) to form flavin adenine dinucleotide (FAD) coenzyme. Alternatively spliced transcript variants encoding distinct isoforms have been observed. [provided by RefSeq, Jul 2008]
Mouse(319945) RFad1, flavin adenine dinucleotide synthetase, homolog (yeast)
Rat(751787) flavin adenine dinucleotide synthetase 1
Zebrafish(445492) FAD1 flavin adenine dinucleotide synthetase homolog (S. cerevisiae)
cow(506682) FAD1 flavin adenine dinucleotide synthetase homolog (S. cerevisiae)
Horse(100063090) FAD1 flavin adenine dinucleotide synthetase homolog (S. cerevisiae)
domestic cat(101092414) FAD1 flavin adenine dinucleotide synthetase homolog (S. cerevisiae)
chicken(100857898) FAD1 flavin adenine dinucleotide synthetase homolog (S. cerevisiae)
dog(490438) FAD1 flavin adenine dinucleotide synthetase homolog (S. cerevisiae)
sheep(101114227) FAD1 flavin adenine dinucleotide synthetase homolog (S. cerevisiae)
naked mole-rat(101716273) flavin adenine dinucleotide synthetase 1
domestic guinea pig(100735304) flavin adenine dinucleotide synthetase 1
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_025207 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_025207 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_025207 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_177041 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_177041 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_177041 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_025207 Rosetta Predictions human pricing
NM_201398 Rosetta Predictions human pricing
NM_001110138 Rosetta Predictions rat pricing
NM_177041 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_025207 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00012514 predicted 1714
2 SASI_Hs01_00012515 predicted 1962
3 SASI_Hs01_00012516 predicted 1699
4 SASI_Hs01_00012518 predicted 1354
5 SASI_Hs01_00012519 predicted 1940
6 SASI_Hs01_00012520 predicted 1616
7 SASI_Hs01_00012521 predicted 1462
8 SASI_Hs01_00012522 predicted 1949
9 SASI_Hs01_00012523 predicted 1442
10 SASI_Hs02_00357983 predicted 1256
11 SASI_Hs01_00012517 predicted 901
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_201398 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00220547 predicted 1272
2 SASI_Hs01_00220548 predicted 1517
3 SASI_Hs01_00220549 predicted 1260
4 SASI_Hs01_00220551 predicted 917
5 SASI_Hs01_00220552 predicted 1494
6 SASI_Hs01_00220553 predicted 1166
7 SASI_Hs01_00220554 predicted 1014
8 SASI_Hs01_00220555 predicted 1512
9 SASI_Hs01_00220556 predicted 995
10 SASI_Hs02_00372931 predicted 813
11 SASI_Hs01_00220550 predicted 458
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001110138 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00251022 predicted 817
2 SASI_Rn02_00251023 predicted 248
3 SASI_Rn02_00251024 predicted 1278
4 SASI_Rn02_00251025 predicted 1509
5 SASI_Rn02_00251026 predicted 1740
6 SASI_Rn02_00251027 predicted 1719
7 SASI_Rn02_00251028 predicted 1278
8 SASI_Rn02_00251029 predicted 967
9 SASI_Rn02_00251030 predicted 1663
10 SASI_Rn02_00251031 predicted 1004
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_177041 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00092991 predicted 725
2 SASI_Mm01_00092992 predicted 939
3 SASI_Mm01_00092993 predicted 1502
4 SASI_Mm01_00092994 predicted 473
5 SASI_Mm01_00092995 predicted 1521
6 SASI_Mm01_00092996 predicted 1286
7 SASI_Mm01_00092997 predicted 1301
8 SASI_Mm01_00092998 predicted 1627
9 SASI_Mm01_00092999 predicted 828
10 SASI_Mm01_00093000 predicted 1530
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_025207
VALIDATED
FLAD1 MISSION shRNA Bacterial Glycerol Stock
flavin adenine dinucleotide synthetase 1
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000300338    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025207.3-1061s21c1
Sequence:CCGGGCACTGGTCAACCTTTCAGATCTCGAGATCTGAAAGGTTGACCAGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000294376    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: A549
TRC Version: 2 Clone ID:NM_025207.3-1000s21c1
Sequence:CCGGGGCTGGGAGAAGCTATCATTGCTCGAGCAATGATAGCTTCTCCCAGCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000294377    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: A549
TRC Version: 2 Clone ID:NM_025207.3-1190s21c1
Sequence:CCGGTCCACTCAAAGGAGCTATATGCTCGAGCATATAGCTCCTTTGAGTGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000294320    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: A549
TRC Version: 2 Clone ID:NM_025207.3-1917s21c1
Sequence:CCGGCTACAGAGACATCTGGGATTTCTCGAGAAATCCCAGATGTCTCTGTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000294392    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: A549
TRC Version: 2 Clone ID:NM_025207.3-705s21c1
Sequence:CCGGTGTTGGAGATGAGATCCTTAACTCGAGTTAAGGATCTCATCTCCAACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000045593    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: A549
TRC Version: 1 Clone ID:NM_025207.3-1061s1c1
Sequence:CCGGGCACTGGTCAACCTTTCAGATCTCGAGATCTGAAAGGTTGACCAGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000045595    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025207.3-1705s1c1
Sequence:CCGGGACACTATCAAGAGGTATAATCTCGAGATTATACCTCTTGATAGTGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000045596    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025207.3-406s1c1
Sequence:CCGGCGCTTGTCAAGGATCTGGTTACTCGAGTAACCAGATCCTTGACAAGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000045594    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: A549
TRC Version: 1 Clone ID:NM_025207.3-1447s1c1
Sequence:CCGGGCTGTATACAAACTCGCTGAACTCGAGTTCAGCGAGTTTGTATACAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000045597    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025207.3-1615s1c1
Sequence:CCGGCAGAGGAAATTACCTGATGTTCTCGAGAACATCAGGTAATTTCCTCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_025207
VALIDATED
FLAD1 MISSION shRNA shRNA Plasmid DNA
flavin adenine dinucleotide synthetase 1
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000300338    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025207.3-1061s21c1
Sequence:CCGGGCACTGGTCAACCTTTCAGATCTCGAGATCTGAAAGGTTGACCAGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000294376    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: A549
TRC Version: 2 Clone ID:NM_025207.3-1000s21c1
Sequence:CCGGGGCTGGGAGAAGCTATCATTGCTCGAGCAATGATAGCTTCTCCCAGCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000294377    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: A549
TRC Version: 2 Clone ID:NM_025207.3-1190s21c1
Sequence:CCGGTCCACTCAAAGGAGCTATATGCTCGAGCATATAGCTCCTTTGAGTGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000294320    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: A549
TRC Version: 2 Clone ID:NM_025207.3-1917s21c1
Sequence:CCGGCTACAGAGACATCTGGGATTTCTCGAGAAATCCCAGATGTCTCTGTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000294392    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: A549
TRC Version: 2 Clone ID:NM_025207.3-705s21c1
Sequence:CCGGTGTTGGAGATGAGATCCTTAACTCGAGTTAAGGATCTCATCTCCAACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000045593    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: A549
TRC Version: 1 Clone ID:NM_025207.3-1061s1c1
Sequence:CCGGGCACTGGTCAACCTTTCAGATCTCGAGATCTGAAAGGTTGACCAGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000045595    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025207.3-1705s1c1
Sequence:CCGGGACACTATCAAGAGGTATAATCTCGAGATTATACCTCTTGATAGTGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000045596    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025207.3-406s1c1
Sequence:CCGGCGCTTGTCAAGGATCTGGTTACTCGAGTAACCAGATCCTTGACAAGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000045594    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: A549
TRC Version: 1 Clone ID:NM_025207.3-1447s1c1
Sequence:CCGGGCTGTATACAAACTCGCTGAACTCGAGTTCAGCGAGTTTGTATACAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000045597    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025207.3-1615s1c1
Sequence:CCGGCAGAGGAAATTACCTGATGTTCTCGAGAACATCAGGTAATTTCCTCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_025207
VALIDATED
FLAD1 MISSION shRNA Lentiviral Transduction Particles
flavin adenine dinucleotide synthetase 1
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000300338    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025207.3-1061s21c1
Sequence:CCGGGCACTGGTCAACCTTTCAGATCTCGAGATCTGAAAGGTTGACCAGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000294376    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: A549
TRC Version: 2 Clone ID:NM_025207.3-1000s21c1
Sequence:CCGGGGCTGGGAGAAGCTATCATTGCTCGAGCAATGATAGCTTCTCCCAGCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000294377    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: A549
TRC Version: 2 Clone ID:NM_025207.3-1190s21c1
Sequence:CCGGTCCACTCAAAGGAGCTATATGCTCGAGCATATAGCTCCTTTGAGTGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000294320    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: A549
TRC Version: 2 Clone ID:NM_025207.3-1917s21c1
Sequence:CCGGCTACAGAGACATCTGGGATTTCTCGAGAAATCCCAGATGTCTCTGTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000294392    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: A549
TRC Version: 2 Clone ID:NM_025207.3-705s21c1
Sequence:CCGGTGTTGGAGATGAGATCCTTAACTCGAGTTAAGGATCTCATCTCCAACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000045593    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: A549
TRC Version: 1 Clone ID:NM_025207.3-1061s1c1
Sequence:CCGGGCACTGGTCAACCTTTCAGATCTCGAGATCTGAAAGGTTGACCAGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000045595    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025207.3-1705s1c1
Sequence:CCGGGACACTATCAAGAGGTATAATCTCGAGATTATACCTCTTGATAGTGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000045596    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025207.3-406s1c1
Sequence:CCGGCGCTTGTCAAGGATCTGGTTACTCGAGTAACCAGATCCTTGACAAGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000045594    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: A549
TRC Version: 1 Clone ID:NM_025207.3-1447s1c1
Sequence:CCGGGCTGTATACAAACTCGCTGAACTCGAGTTCAGCGAGTTTGTATACAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000045597    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025207.3-1615s1c1
Sequence:CCGGCAGAGGAAATTACCTGATGTTCTCGAGAACATCAGGTAATTTCCTCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_177041
VALIDATED
FLAD1 MISSION shRNA Bacterial Glycerol Stock
flavin adenine dinucleotide synthetase 1
Mouse
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000251093    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.85 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_177041.3-1742s21c1
Sequence:CCGGGCTACCTGTCATGTCAGTAAACTCGAGTTTACTGACATGACAGGTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000251095    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177041.3-1531s21c1
Sequence:CCGGGTCCCATACTGCATCCTATATCTCGAGATATAGGATGCAGTATGGGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000215847    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_177041.3-1870s1c1
Sequence:CCGGCAGGAGTAACATAGAACATACCTCGAGGTATGTTCTATGTTACTCCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000251096    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_177041.3-409s21c1
Sequence:CCGGGCATCCGAGGTCAACTCATTCCTCGAGGAATGAGTTGACCTCGGATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000251094    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_177041.3-282s21c1
Sequence:CCGGTGTTGGAGATGAGATCCTTAACTCGAGTTAAGGATCTCATCTCCAACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000258121    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_177041.3-875s21c1
Sequence:CCGGACTGGAGCAGCAACTACTTTCCTCGAGGAAAGTAGTTGCTGCTCCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000191355    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_177041.2-891s1c1
Sequence:CCGGCAGCAACTACTTTCAAGTGAACTCGAGTTCACTTGAAAGTAGTTGCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000191115    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_177041.2-321s1c1
Sequence:CCGGGCAAGATACCAACACTTACTTCTCGAGAAGTAAGTGTTGGTATCTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_177041
VALIDATED
FLAD1 MISSION shRNA shRNA Plasmid DNA
flavin adenine dinucleotide synthetase 1
Mouse
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000251093    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.85 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_177041.3-1742s21c1
Sequence:CCGGGCTACCTGTCATGTCAGTAAACTCGAGTTTACTGACATGACAGGTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000251095    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177041.3-1531s21c1
Sequence:CCGGGTCCCATACTGCATCCTATATCTCGAGATATAGGATGCAGTATGGGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000215847    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_177041.3-1870s1c1
Sequence:CCGGCAGGAGTAACATAGAACATACCTCGAGGTATGTTCTATGTTACTCCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000251096    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_177041.3-409s21c1
Sequence:CCGGGCATCCGAGGTCAACTCATTCCTCGAGGAATGAGTTGACCTCGGATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000251094    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_177041.3-282s21c1
Sequence:CCGGTGTTGGAGATGAGATCCTTAACTCGAGTTAAGGATCTCATCTCCAACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000258121    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_177041.3-875s21c1
Sequence:CCGGACTGGAGCAGCAACTACTTTCCTCGAGGAAAGTAGTTGCTGCTCCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000191355    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_177041.2-891s1c1
Sequence:CCGGCAGCAACTACTTTCAAGTGAACTCGAGTTCACTTGAAAGTAGTTGCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000191115    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_177041.2-321s1c1
Sequence:CCGGGCAAGATACCAACACTTACTTCTCGAGAAGTAAGTGTTGGTATCTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_177041
VALIDATED
FLAD1 MISSION shRNA Lentiviral Transduction Particles
flavin adenine dinucleotide synthetase 1
Mouse
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000251093    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.85 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_177041.3-1742s21c1
Sequence:CCGGGCTACCTGTCATGTCAGTAAACTCGAGTTTACTGACATGACAGGTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000251095    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177041.3-1531s21c1
Sequence:CCGGGTCCCATACTGCATCCTATATCTCGAGATATAGGATGCAGTATGGGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000215847    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_177041.3-1870s1c1
Sequence:CCGGCAGGAGTAACATAGAACATACCTCGAGGTATGTTCTATGTTACTCCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000251096    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_177041.3-409s21c1
Sequence:CCGGGCATCCGAGGTCAACTCATTCCTCGAGGAATGAGTTGACCTCGGATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000251094    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_177041.3-282s21c1
Sequence:CCGGTGTTGGAGATGAGATCCTTAACTCGAGTTAAGGATCTCATCTCCAACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000258121    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_177041.3-875s21c1
Sequence:CCGGACTGGAGCAGCAACTACTTTCCTCGAGGAAAGTAGTTGCTGCTCCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000191355    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_177041.2-891s1c1
Sequence:CCGGCAGCAACTACTTTCAAGTGAACTCGAGTTCACTTGAAAGTAGTTGCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000191115    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_177041.2-321s1c1
Sequence:CCGGGCAAGATACCAACACTTACTTCTCGAGAAGTAAGTGTTGGTATCTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks