EMAIL THIS PAGE TO A FRIEND

FLCN

folliculin

64 Gene Product Result for
Synonyms: BHD FLCL
UniProtKB ID: Q8NFG4, A6NJJ8, Q6ZRX1, Q96BD2, Q96BE4
Gene ID:
Human(201163) Summary: This gene is located within the Smith-Magenis syndrome region on chromosome 17. Mutations in this gene are associated with Birt-Hogg-Dube syndrome, which is characterized by fibrofolliculomas, renal tumors, lung cysts, and pneumothorax. Alternative splicing of this gene results in two transcript variants encoding different isoforms. [provided by RefSeq, Jul 2008]
Mouse(216805) folliculin
Rat(303185) folliculin
Zebrafish(678628) folliculin
dog(479529) folliculin
chicken(416503) folliculin
cow(526652) folliculin
sheep(101121947) folliculin
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_144997 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_144997 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_144997 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_146018 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_146018 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_146018 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU006461 MISSION® esiRNA esiRNA targeting human FLCN (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_144606 Rosetta Predictions human pricing
NM_144997 Rosetta Predictions human pricing
NM_199390 Rosetta Predictions rat pricing
NM_146018 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_144606 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00238665 predicted 1122
2 SASI_Hs01_00238666 predicted 778
3 SASI_Hs01_00238667 predicted 784
4 SASI_Hs01_00238668 predicted 776
5 SASI_Hs01_00238669 predicted 1033
6 SASI_Hs02_00364409 predicted 1151
7 SASI_Hs01_00238671 predicted 1020
8 SASI_Hs01_00238673 predicted 930
9 SASI_Hs02_00364410 predicted 640
10 SASI_Hs02_00364411 predicted 946
11 SASI_Hs01_00238670 predicted 798
12 SASI_Hs01_00238672 predicted 509
13 SASI_Hs01_00238674 predicted 860
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_144997 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00218319 predicted 1114
2 SASI_Hs01_00218320 predicted 773
3 SASI_Hs01_00218321 predicted 779
4 SASI_Hs01_00218322 predicted 779
5 SASI_Hs01_00218323 predicted 1039
6 SASI_Hs02_00364828 predicted 1153
7 SASI_Hs01_00218325 predicted 1019
8 SASI_Hs01_00218327 predicted 933
9 SASI_Hs02_00364829 predicted 642
10 SASI_Hs02_00364830 predicted 941
11 SASI_Hs01_00218324 predicted 789
12 SASI_Hs01_00218326 predicted 508
13 SASI_Hs01_00218328 predicted 860
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_199390 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00088498 predicted 1231
2 SASI_Rn02_00270213 predicted 836
3 SASI_Rn01_00088500 predicted 2197
4 SASI_Rn01_00088501 predicted 695
5 SASI_Rn01_00088502 predicted 2053
6 SASI_Rn01_00088503 predicted 1796
7 SASI_Rn01_00088504 predicted 930
8 SASI_Rn01_00088505 predicted 698
9 SASI_Rn01_00088506 predicted 1306
10 SASI_Rn01_00088507 predicted 1551
11 SASI_Rn01_00088499 predicted 2192
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_146018 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00084656 predicted 868
2 SASI_Mm01_00084657 predicted 1282
3 SASI_Mm01_00084658 predicted 1631
4 SASI_Mm01_00084659 predicted 770
5 SASI_Mm01_00084660 predicted 1063
6 SASI_Mm01_00084661 predicted 1844
7 SASI_Mm01_00084662 predicted 1786
8 SASI_Mm01_00084663 predicted 1534
9 SASI_Mm01_00084664 predicted 1690
10 SASI_Mm02_00341581 predicted 1287
11 SASI_Mm01_00084655 predicted 1138
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_144997
VALIDATED
FLCN MISSION shRNA Bacterial Glycerol Stock
folliculin
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000005968    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_144997.3-3015s1c1
Sequence:CCGGGCTGCTTTCAACATTTACGTTCTCGAGAACGTAAATGTTGAAAGCAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000005971    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144997.3-652s1c1
Sequence:CCGGCATTCAGATGAACAGTCGGATCTCGAGATCCGACTGTTCATCTGAATGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000005970    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144997.3-2176s1c1
Sequence:CCGGGACCTACAAGTCACACCTCATCTCGAGATGAGGTGTGACTTGTAGGTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000005969    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: A549
TRC Version: 1 Clone ID:NM_144997.3-776s1c1
Sequence:CCGGCCGGGATATATCAGCCATGATCTCGAGATCATGGCTGATATATCCCGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000010979    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144997.3-1937s1c1
Sequence:CCGGCCCACCATCCTGAATAAGATTCTCGAGAATCTTATTCAGGATGGTGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000237886    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: A549
TRC Version: 2 Clone ID:NM_144997.5-1359s21c1
Sequence:CCGGGATGGAGAAGCTCGCTGATTTCTCGAGAAATCAGCGAGCTTCTCCATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000237885    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: A549
TRC Version: 2 Clone ID:NM_144997.5-1880s21c1
Sequence:CCGGCTCTCAGCAAGTACGAGTTTGCTCGAGCAAACTCGTACTTGCTGAGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000237884    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144997.5-799s21c1
Sequence:CCGGGATAAAGAGACCTCCATTAAACTCGAGTTTAATGGAGGTCTCTTTATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000237883    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144997.5-1943s21c1
Sequence:CCGGCCACCATCCTGAATAAGATTGCTCGAGCAATCTTATTCAGGATGGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000237882    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_144997.5-2587s21c1
Sequence:CCGGTCAGTATGCAGTCGCAATAACCTCGAGGTTATTGCGACTGCATACTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_144997
VALIDATED
FLCN MISSION shRNA shRNA Plasmid DNA
folliculin
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000005968    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_144997.3-3015s1c1
Sequence:CCGGGCTGCTTTCAACATTTACGTTCTCGAGAACGTAAATGTTGAAAGCAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000005971    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144997.3-652s1c1
Sequence:CCGGCATTCAGATGAACAGTCGGATCTCGAGATCCGACTGTTCATCTGAATGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000005970    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144997.3-2176s1c1
Sequence:CCGGGACCTACAAGTCACACCTCATCTCGAGATGAGGTGTGACTTGTAGGTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000005969    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: A549
TRC Version: 1 Clone ID:NM_144997.3-776s1c1
Sequence:CCGGCCGGGATATATCAGCCATGATCTCGAGATCATGGCTGATATATCCCGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000010979    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144997.3-1937s1c1
Sequence:CCGGCCCACCATCCTGAATAAGATTCTCGAGAATCTTATTCAGGATGGTGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000237886    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: A549
TRC Version: 2 Clone ID:NM_144997.5-1359s21c1
Sequence:CCGGGATGGAGAAGCTCGCTGATTTCTCGAGAAATCAGCGAGCTTCTCCATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000237885    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: A549
TRC Version: 2 Clone ID:NM_144997.5-1880s21c1
Sequence:CCGGCTCTCAGCAAGTACGAGTTTGCTCGAGCAAACTCGTACTTGCTGAGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000237884    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144997.5-799s21c1
Sequence:CCGGGATAAAGAGACCTCCATTAAACTCGAGTTTAATGGAGGTCTCTTTATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000237883    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144997.5-1943s21c1
Sequence:CCGGCCACCATCCTGAATAAGATTGCTCGAGCAATCTTATTCAGGATGGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000237882    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_144997.5-2587s21c1
Sequence:CCGGTCAGTATGCAGTCGCAATAACCTCGAGGTTATTGCGACTGCATACTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_144997
VALIDATED
FLCN MISSION shRNA Lentiviral Transduction Particles
folliculin
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000005968    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_144997.3-3015s1c1
Sequence:CCGGGCTGCTTTCAACATTTACGTTCTCGAGAACGTAAATGTTGAAAGCAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000005971    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144997.3-652s1c1
Sequence:CCGGCATTCAGATGAACAGTCGGATCTCGAGATCCGACTGTTCATCTGAATGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000005970    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144997.3-2176s1c1
Sequence:CCGGGACCTACAAGTCACACCTCATCTCGAGATGAGGTGTGACTTGTAGGTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000005969    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: A549
TRC Version: 1 Clone ID:NM_144997.3-776s1c1
Sequence:CCGGCCGGGATATATCAGCCATGATCTCGAGATCATGGCTGATATATCCCGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000010979    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144997.3-1937s1c1
Sequence:CCGGCCCACCATCCTGAATAAGATTCTCGAGAATCTTATTCAGGATGGTGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000237886    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: A549
TRC Version: 2 Clone ID:NM_144997.5-1359s21c1
Sequence:CCGGGATGGAGAAGCTCGCTGATTTCTCGAGAAATCAGCGAGCTTCTCCATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000237885    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: A549
TRC Version: 2 Clone ID:NM_144997.5-1880s21c1
Sequence:CCGGCTCTCAGCAAGTACGAGTTTGCTCGAGCAAACTCGTACTTGCTGAGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000237884    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144997.5-799s21c1
Sequence:CCGGGATAAAGAGACCTCCATTAAACTCGAGTTTAATGGAGGTCTCTTTATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000237883    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144997.5-1943s21c1
Sequence:CCGGCCACCATCCTGAATAAGATTGCTCGAGCAATCTTATTCAGGATGGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000237882    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_144997.5-2587s21c1
Sequence:CCGGTCAGTATGCAGTCGCAATAACCTCGAGGTTATTGCGACTGCATACTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_146018
VALIDATED
FLCN MISSION shRNA Bacterial Glycerol Stock
folliculin
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000077483    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_146018.1-2709s1c1
Sequence:CCGGGCTTGGAAAGATTTCCTGAAACTCGAGTTTCAGGAAATCTTTCCAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000077487    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_146018.1-1287s1c1
Sequence:CCGGCTTCAAGTCTCTTCGACACATCTCGAGATGTGTCGAAGAGACTTGAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000077484    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_146018.1-1690s1c1
Sequence:CCGGCCCACTATCCTGAATAAGATTCTCGAGAATCTTATTCAGGATAGTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000077485    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_146018.1-529s1c1
Sequence:CCGGCCAGGCTATATCAGTCATGATCTCGAGATCATGACTGATATAGCCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000077486    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_146018.1-1135s1c1
Sequence:CCGGGAATCAGAAAGTTGGGACAATCTCGAGATTGTCCCAACTTTCTGATTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000310871    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_146018.1-2153s21c1
Sequence:CCGGAGTGGTCCCTTTGCATCAAACCTCGAGGTTTGATGCAAAGGGACCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000304276    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_146018.1-1877s21c1
Sequence:CCGGCAGAGGAGGACAACGTCAAACCTCGAGGTTTGACGTTGTCCTCCTCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000304275    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_146018.1-710s21c1
Sequence:CCGGGCCACACCTTCTTCATCAAAGCTCGAGCTTTGATGAAGAAGGTGTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000301434    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_146018.1-1287s21c1
Sequence:CCGGCTTCAAGTCTCTTCGACACATCTCGAGATGTGTCGAAGAGACTTGAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000301435    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_146018.1-1135s21c1
Sequence:CCGGGAATCAGAAAGTTGGGACAATCTCGAGATTGTCCCAACTTTCTGATTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_146018
VALIDATED
FLCN MISSION shRNA shRNA Plasmid DNA
folliculin
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000077483    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_146018.1-2709s1c1
Sequence:CCGGGCTTGGAAAGATTTCCTGAAACTCGAGTTTCAGGAAATCTTTCCAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000077487    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_146018.1-1287s1c1
Sequence:CCGGCTTCAAGTCTCTTCGACACATCTCGAGATGTGTCGAAGAGACTTGAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000077484    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_146018.1-1690s1c1
Sequence:CCGGCCCACTATCCTGAATAAGATTCTCGAGAATCTTATTCAGGATAGTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000077485    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_146018.1-529s1c1
Sequence:CCGGCCAGGCTATATCAGTCATGATCTCGAGATCATGACTGATATAGCCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000077486    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_146018.1-1135s1c1
Sequence:CCGGGAATCAGAAAGTTGGGACAATCTCGAGATTGTCCCAACTTTCTGATTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000310871    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_146018.1-2153s21c1
Sequence:CCGGAGTGGTCCCTTTGCATCAAACCTCGAGGTTTGATGCAAAGGGACCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000304276    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_146018.1-1877s21c1
Sequence:CCGGCAGAGGAGGACAACGTCAAACCTCGAGGTTTGACGTTGTCCTCCTCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000304275    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_146018.1-710s21c1
Sequence:CCGGGCCACACCTTCTTCATCAAAGCTCGAGCTTTGATGAAGAAGGTGTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000301434    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_146018.1-1287s21c1
Sequence:CCGGCTTCAAGTCTCTTCGACACATCTCGAGATGTGTCGAAGAGACTTGAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000301435    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_146018.1-1135s21c1
Sequence:CCGGGAATCAGAAAGTTGGGACAATCTCGAGATTGTCCCAACTTTCTGATTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_146018
VALIDATED
FLCN MISSION shRNA Lentiviral Transduction Particles
folliculin
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000077483    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_146018.1-2709s1c1
Sequence:CCGGGCTTGGAAAGATTTCCTGAAACTCGAGTTTCAGGAAATCTTTCCAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000077487    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_146018.1-1287s1c1
Sequence:CCGGCTTCAAGTCTCTTCGACACATCTCGAGATGTGTCGAAGAGACTTGAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000077484    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_146018.1-1690s1c1
Sequence:CCGGCCCACTATCCTGAATAAGATTCTCGAGAATCTTATTCAGGATAGTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000077485    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_146018.1-529s1c1
Sequence:CCGGCCAGGCTATATCAGTCATGATCTCGAGATCATGACTGATATAGCCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000077486    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_146018.1-1135s1c1
Sequence:CCGGGAATCAGAAAGTTGGGACAATCTCGAGATTGTCCCAACTTTCTGATTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000310871    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_146018.1-2153s21c1
Sequence:CCGGAGTGGTCCCTTTGCATCAAACCTCGAGGTTTGATGCAAAGGGACCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000304276    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_146018.1-1877s21c1
Sequence:CCGGCAGAGGAGGACAACGTCAAACCTCGAGGTTTGACGTTGTCCTCCTCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000304275    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_146018.1-710s21c1
Sequence:CCGGGCCACACCTTCTTCATCAAAGCTCGAGCTTTGATGAAGAAGGTGTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000301434    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_146018.1-1287s21c1
Sequence:CCGGCTTCAAGTCTCTTCGACACATCTCGAGATGTGTCGAAGAGACTTGAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000301435    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_146018.1-1135s21c1
Sequence:CCGGGAATCAGAAAGTTGGGACAATCTCGAGATTGTCCCAACTTTCTGATTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks