EMAIL THIS PAGE TO A FRIEND

FLG2

filaggrin family member 2

46 Gene Product Result for
Synonyms: IFPS
UniProtKB ID: Q5D862, Q9H4U1
Gene ID:
Mouse(229574) filaggrin family member 2
domestic cat(101086079) filaggrin family member 2
cow(101909133) filaggrin family member 2
dog(483211) filaggrin family member 2
domestic guinea pig(101787533) filaggrin family member 2
naked mole-rat(101700194) filaggrin family member 2
sheep(101120628) filaggrin family member 2
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-XM_371313 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-XM_371313 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-XM_371313 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_001013804 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_001013804 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_001013804 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001014342 Rosetta Predictions human pricing
NM_001013804 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001014342 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00074803 predicted 1900
2 SASI_Hs01_00074804 predicted 704
3 SASI_Hs01_00074805 predicted 1674
4 SASI_Hs01_00074807 predicted 5174
5 SASI_Hs01_00074809 predicted 7251
6 SASI_Hs01_00074810 predicted 1434
7 SASI_Hs02_00306530 predicted 3496
8 SASI_Hs02_00306531 predicted 1324
9 SASI_Hs01_00074806 predicted 5111
10 SASI_Hs01_00074808 predicted 3881
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001013804 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00053712 predicted 1097
2 SASI_Mm01_00053713 predicted 4902
3 SASI_Mm01_00053714 predicted 730
4 SASI_Mm01_00053715 predicted 3490
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-XM_371313
FLG2 MISSION shRNA Bacterial Glycerol Stock
filaggrin family member 2
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000055643    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_371313.1-625s1c1
Sequence:CCGGGCTCTGTAGAACTGAGAGAAACTCGAGTTTCTCTCAGTTCTACAGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000055644    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_371313.1-254s1c1
Sequence:CCGGGATGATATTCAAGCTGACTATCTCGAGATAGTCAGCTTGAATATCATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000055645    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_371313.1-153s1c1
Sequence:CCGGCCAGTTCTGAAGAACCCAGATCTCGAGATCTGGGTTCTTCAGAACTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000055646    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_371313.1-716s1c1
Sequence:CCGGCAGTTGGGAAAGGAAAGATTTCTCGAGAAATCTTTCCTTTCCCAACTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000055647    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_371313.1-290s1c1
Sequence:CCGGCCTCAGCAAAGAATACTGCAACTCGAGTTGCAGTATTCTTTGCTGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-XM_371313
FLG2 MISSION shRNA shRNA Plasmid DNA
filaggrin family member 2
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000055643    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_371313.1-625s1c1
Sequence:CCGGGCTCTGTAGAACTGAGAGAAACTCGAGTTTCTCTCAGTTCTACAGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000055644    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_371313.1-254s1c1
Sequence:CCGGGATGATATTCAAGCTGACTATCTCGAGATAGTCAGCTTGAATATCATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000055645    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_371313.1-153s1c1
Sequence:CCGGCCAGTTCTGAAGAACCCAGATCTCGAGATCTGGGTTCTTCAGAACTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000055646    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_371313.1-716s1c1
Sequence:CCGGCAGTTGGGAAAGGAAAGATTTCTCGAGAAATCTTTCCTTTCCCAACTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000055647    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_371313.1-290s1c1
Sequence:CCGGCCTCAGCAAAGAATACTGCAACTCGAGTTGCAGTATTCTTTGCTGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-XM_371313
FLG2 MISSION shRNA Lentiviral Transduction Particles
filaggrin family member 2
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000055643    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_371313.1-625s1c1
Sequence:CCGGGCTCTGTAGAACTGAGAGAAACTCGAGTTTCTCTCAGTTCTACAGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000055644    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_371313.1-254s1c1
Sequence:CCGGGATGATATTCAAGCTGACTATCTCGAGATAGTCAGCTTGAATATCATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000055645    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_371313.1-153s1c1
Sequence:CCGGCCAGTTCTGAAGAACCCAGATCTCGAGATCTGGGTTCTTCAGAACTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000055646    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_371313.1-716s1c1
Sequence:CCGGCAGTTGGGAAAGGAAAGATTTCTCGAGAAATCTTTCCTTTCCCAACTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000055647    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_371313.1-290s1c1
Sequence:CCGGCCTCAGCAAAGAATACTGCAACTCGAGTTGCAGTATTCTTTGCTGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001013804
FLG2 MISSION shRNA Bacterial Glycerol Stock
filaggrin family member 2
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000265362    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001013804.1-1592s21c1
Sequence:CCGGGTCATCTAGCTCTAGGCATAACTCGAGTTATGCCTAGAGCTAGATGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000253251    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001013804.1-1080s21c1
Sequence:CCGGTCTAGATGTTGTCAACCTAAACTCGAGTTTAGGTTGACAACATCTAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000253249    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001013804.1-740s21c1
Sequence:CCGGTGAGTCTGGATATAGGTTAAACTCGAGTTTAACCTATATCCAGACTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000253250    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001013804.1-277s21c1
Sequence:CCGGATGACCGAAGACTAGACTTTACTCGAGTAAAGTCTAGTCTTCGGTCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000253252    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001013804.1-2182s21c1
Sequence:CCGGCATCTAGCTCTGGGCATAATGCTCGAGCATTATGCCCAGAGCTAGATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001013804
FLG2 MISSION shRNA shRNA Plasmid DNA
filaggrin family member 2
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000265362    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001013804.1-1592s21c1
Sequence:CCGGGTCATCTAGCTCTAGGCATAACTCGAGTTATGCCTAGAGCTAGATGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000253251    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001013804.1-1080s21c1
Sequence:CCGGTCTAGATGTTGTCAACCTAAACTCGAGTTTAGGTTGACAACATCTAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000253249    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001013804.1-740s21c1
Sequence:CCGGTGAGTCTGGATATAGGTTAAACTCGAGTTTAACCTATATCCAGACTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000253250    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001013804.1-277s21c1
Sequence:CCGGATGACCGAAGACTAGACTTTACTCGAGTAAAGTCTAGTCTTCGGTCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000253252    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001013804.1-2182s21c1
Sequence:CCGGCATCTAGCTCTGGGCATAATGCTCGAGCATTATGCCCAGAGCTAGATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001013804
FLG2 MISSION shRNA Lentiviral Transduction Particles
filaggrin family member 2
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000265362    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001013804.1-1592s21c1
Sequence:CCGGGTCATCTAGCTCTAGGCATAACTCGAGTTATGCCTAGAGCTAGATGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000253251    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001013804.1-1080s21c1
Sequence:CCGGTCTAGATGTTGTCAACCTAAACTCGAGTTTAGGTTGACAACATCTAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000253249    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001013804.1-740s21c1
Sequence:CCGGTGAGTCTGGATATAGGTTAAACTCGAGTTTAACCTATATCCAGACTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000253250    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001013804.1-277s21c1
Sequence:CCGGATGACCGAAGACTAGACTTTACTCGAGTAAAGTCTAGTCTTCGGTCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000253252    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001013804.1-2182s21c1
Sequence:CCGGCATCTAGCTCTGGGCATAATGCTCGAGCATTATGCCCAGAGCTAGATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks