EMAIL THIS PAGE TO A FRIEND

FLG

filaggrin

65 Gene Product Result for
Synonyms: ATOD2
Species: Human FLG(2312), Mouse Flg(14246), Rat Flg(24641), cow FLG(788551), naked mole-rat Flg(101699480), domestic guinea pig Flg(100728006)
UniProtKB ID: P20930, Q01720, Q5T583, Q9UC71
Gene ID:
Human(2312) Summary: The protein encoded by this gene is an intermediate filament-associated protein that aggregates keratin intermediate filaments in mammalian epidermis. It is initially synthesized as a polyprotein precursor, profilaggrin (consisting of multiple filaggrin units of 324 aa each), which is localized in keratohyalin granules, and is subsequently proteolytically processed into individual functional filaggrin molecules. Mutations in this gene are associated with ichthyosis vulgaris.[provided by RefSeq, Dec 2009]
Mouse(14246) filaggrin
Rat(24641) filaggrin
cow(788551) filaggrin
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_002016 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_002016 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_002016 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-XM_048104 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-XM_048104 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-XM_048104 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU030861 MISSION® esiRNA esiRNA human FLG (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_002016 Rosetta Predictions human pricing
XM_001054999 Rosetta Predictions rat pricing
XM_238235 Rosetta Predictions rat pricing
XM_001481265 Rosetta Predictions mouse pricing
XM_485270 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_002016 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00333017 predicted 744
2 SASI_Hs02_00333018 predicted 11963
3 SASI_Hs01_00231313 predicted 4218
4 SASI_Hs02_00333019 predicted 2960
5 SASI_Hs01_00231314 predicted 5510
6 SASI_Hs02_00333020 predicted 4811
7 SASI_Hs02_00333021 predicted 11843
8 SASI_Hs01_00231317 predicted 12092
9 SASI_Hs02_00333022 predicted 12280
10 SASI_Hs01_00231318 predicted 4447
11 SASI_Hs01_00231311 predicted 3191
12 SASI_Hs01_00231312 predicted 12118
13 SASI_Hs01_00231315 predicted 6934
14 SASI_Hs01_00231316 predicted 7912
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001054999 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00278006 predicted 2146
2 SASI_Rn02_00278007 predicted 2083
3 SASI_Rn02_00278008 predicted 2107
4 SASI_Rn02_00278009 predicted 1993
5 SASI_Rn02_00278010 predicted 2067
6 SASI_Rn02_00278011 predicted 2036
7 SASI_Rn02_00278012 predicted 2199
8 SASI_Rn02_00278013 predicted 1722
9 SASI_Rn02_00278014 predicted 2153
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_238235 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00391266 predicted 507
2 SASI_Rn02_00391267 predicted 215
3 SASI_Rn02_00391268 predicted 2678
4 SASI_Rn02_00391269 predicted 530
5 SASI_Rn02_00391270 predicted 507
6 SASI_Rn02_00391271 predicted 536
7 SASI_Rn02_00391272 predicted 302
8 SASI_Rn02_00391273 predicted 373
9 SASI_Rn02_00391274 predicted 571
10 SASI_Rn02_00391275 predicted 225
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001481265 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00423226 predicted 2343
2 SASI_Mm02_00423227 predicted 701
3 SASI_Mm02_00423228 predicted 259
4 SASI_Mm02_00423229 predicted 529
5 SASI_Mm02_00423230 predicted 725
6 SASI_Mm02_00423231 predicted 708
7 SASI_Mm02_00423232 predicted 364
8 SASI_Mm02_00423233 predicted 2326
9 SASI_Mm02_00423234 predicted 658
10 SASI_Mm02_00423235 predicted 197
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_485270 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00218573 predicted 7035
2 SASI_Mm02_00426631 predicted 312
3 SASI_Mm01_00218574 predicted 3237
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_002016
FLG MISSION shRNA Bacterial Glycerol Stock
filaggrin
Human
4 Products Total
TRC Number Price Set Price (4)? Select
TRCN0000430958    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_002016.1-12437s21c1
Sequence:CCGGTATCATGGAGAGCTAACTTTACTCGAGTAAAGTTAGCTCTCCATGATATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000428827    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002016.1-662s21c1
Sequence:CCGGACAATGAAGAAGGAGTATATGCTCGAGCATATACTCCTTCTTCATTGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000413743    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_002016.1-12358s21c1
Sequence:CCGGTAGTTTGGTGGTAGCTTATTTCTCGAGAAATAAGCTACCACCAAACTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000430344    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002016.1-12113s21c1
Sequence:CCGGGGTATTATGCAACGTATATTACTCGAGTAATATACGTTGCATAATACCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_002016
FLG MISSION shRNA shRNA Plasmid DNA
filaggrin
Human
4 Products Total
TRC Number Vector Price Set Price (4)? Select
TRCN0000430958    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_002016.1-12437s21c1
Sequence:CCGGTATCATGGAGAGCTAACTTTACTCGAGTAAAGTTAGCTCTCCATGATATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000428827    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002016.1-662s21c1
Sequence:CCGGACAATGAAGAAGGAGTATATGCTCGAGCATATACTCCTTCTTCATTGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000413743    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_002016.1-12358s21c1
Sequence:CCGGTAGTTTGGTGGTAGCTTATTTCTCGAGAAATAAGCTACCACCAAACTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000430344    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002016.1-12113s21c1
Sequence:CCGGGGTATTATGCAACGTATATTACTCGAGTAATATACGTTGCATAATACCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_002016
FLG MISSION shRNA Lentiviral Transduction Particles
filaggrin
Human
4 Products Total
TRC Number Volume Titer Vector Price Set Price (4)? Select
TRCN0000430958    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_002016.1-12437s21c1
Sequence:CCGGTATCATGGAGAGCTAACTTTACTCGAGTAAAGTTAGCTCTCCATGATATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000428827    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002016.1-662s21c1
Sequence:CCGGACAATGAAGAAGGAGTATATGCTCGAGCATATACTCCTTCTTCATTGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000413743    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_002016.1-12358s21c1
Sequence:CCGGTAGTTTGGTGGTAGCTTATTTCTCGAGAAATAAGCTACCACCAAACTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000430344    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002016.1-12113s21c1
Sequence:CCGGGGTATTATGCAACGTATATTACTCGAGTAATATACGTTGCATAATACCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-XM_048104
FLG MISSION shRNA Bacterial Glycerol Stock
filaggrin
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000083678    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_048104.4-725s1c1
Sequence:CCGGCAGGCCATATTGCCACATATTCTCGAGAATATGTGGCAATATGGCCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000083679    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_048104.4-4307s1c1
Sequence:CCGGCCAGGTCCCATCAAGAAGATACTCGAGTATCTTCTTGATGGGACCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000083681    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_048104.4-1984s1c1
Sequence:CCGGGCACTCGTCACACACAGAATTCTCGAGAATTCTGTGTGTGACGAGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000083682    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_048104.4-186s1c1
Sequence:CCGGCCCAGATATGGTTGATGTCTTCTCGAGAAGACATCAACCATATCTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000083680    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_048104.4-2761s1c1
Sequence:CCGGCCAGTGATAGTGAGCACTCATCTCGAGATGAGTGCTCACTATCACTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-XM_048104
FLG MISSION shRNA shRNA Plasmid DNA
filaggrin
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000083678    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_048104.4-725s1c1
Sequence:CCGGCAGGCCATATTGCCACATATTCTCGAGAATATGTGGCAATATGGCCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000083679    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_048104.4-4307s1c1
Sequence:CCGGCCAGGTCCCATCAAGAAGATACTCGAGTATCTTCTTGATGGGACCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000083681    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_048104.4-1984s1c1
Sequence:CCGGGCACTCGTCACACACAGAATTCTCGAGAATTCTGTGTGTGACGAGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000083682    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_048104.4-186s1c1
Sequence:CCGGCCCAGATATGGTTGATGTCTTCTCGAGAAGACATCAACCATATCTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000083680    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_048104.4-2761s1c1
Sequence:CCGGCCAGTGATAGTGAGCACTCATCTCGAGATGAGTGCTCACTATCACTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-XM_048104
FLG MISSION shRNA Lentiviral Transduction Particles
filaggrin
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000083678    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_048104.4-725s1c1
Sequence:CCGGCAGGCCATATTGCCACATATTCTCGAGAATATGTGGCAATATGGCCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000083679    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_048104.4-4307s1c1
Sequence:CCGGCCAGGTCCCATCAAGAAGATACTCGAGTATCTTCTTGATGGGACCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000083681    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_048104.4-1984s1c1
Sequence:CCGGGCACTCGTCACACACAGAATTCTCGAGAATTCTGTGTGTGACGAGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000083682    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_048104.4-186s1c1
Sequence:CCGGCCCAGATATGGTTGATGTCTTCTCGAGAAGACATCAACCATATCTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000083680    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_048104.4-2761s1c1
Sequence:CCGGCCAGTGATAGTGAGCACTCATCTCGAGATGAGTGCTCACTATCACTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks