EMAIL THIS PAGE TO A FRIEND

FLI1

Fli-1 proto-oncogene, ETS transcription factor

168 Gene Product Result for
Synonyms: EWSR2 SIC-1
Gene ID:
Human(2313) Summary: This gene encodes a transcription factor containing an ETS DNA-binding domain. The gene can undergo a t(11;22)(q24;q12) translocation with the Ewing sarcoma gene on chromosome 22, which results in a fusion gene that is present in the majority of Ewing sarcoma cases. An acute lymphoblastic leukemia-associated t(4;11)(q21;q23) translocation involving this gene has also been identified. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Aug 2012]
Mouse(14247) Friend leukemia integration 1
Rat(315532) Fli-1 proto-oncogene, ETS transcription factor
chicken(419723) Friend leukemia virus integration 1
Horse(100064591) Friend leukemia virus integration 1
cow(529124) Friend leukemia virus integration 1
domestic cat(101090716) Friend leukemia virus integration 1
dog(489286) Friend leukemia virus integration 1
sheep(101115412) Friend leukemia virus integration 1
naked mole-rat(101718977) Friend leukemia virus integration 1
domestic guinea pig(100716275) Friend leukemia virus integration 1
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
F0176 Anti-FLI-1 antibody produced in sheep fractionated antiserum, buffered aqueous solution human, mouse
western blot pricing
SAB1412435 ANTI-FLI1 antibody produced in mouse clone 2A2, purified immunoglobulin, buffered aqueous solution , human
ELISA, immunofluorescence, immunohistochemistry, western blot pricing
SAB1412436 ANTI-FLI1 antibody produced in mouse clone 2G5, purified immunoglobulin, buffered aqueous solution human
ELISA, immunofluorescence, immunohistochemistry, western blot pricing
SAB1412437 ANTI-FLI1 antibody produced in mouse clone 2D6, purified immunoglobulin, buffered aqueous solution , human
ELISA, immunofluorescence, immunohistochemistry, western blot pricing
SAB1412438 ANTI-FLI1 antibody produced in mouse clone 1H4, purified immunoglobulin, buffered aqueous solution human
ELISA, immunofluorescence, immunohistochemistry, western blot pricing
SAB1412439 ANTI-FLI1 antibody produced in mouse clone 2F3, purified immunoglobulin, buffered aqueous solution human
ELISA, immunofluorescence, immunohistochemistry, western blot pricing
SAB1412503 ANTI-FLI1 antibody produced in mouse clone 1G8, purified immunoglobulin, buffered aqueous solution human
ELISA, immunofluorescence, immunohistochemistry, western blot pricing
SAB1412563 ANTI-FLI1 antibody produced in mouse clone 2C10, purified immunoglobulin, buffered aqueous solution human
ELISA, immunofluorescence, immunohistochemistry, western blot pricing
SAB1412564 ANTI-FLI1 antibody produced in mouse clone 2E6, purified immunoglobulin, buffered aqueous solution human
ELISA, immunofluorescence, immunohistochemistry, western blot pricing
SAB2108308 Anti-FLI1 antibody produced in rabbit affinity isolated antibody human, mouse, rat, horse, guinea pig, rabbit, bovine, zebrafish
western blot pricing
AV38096 Anti-FLI1 antibody produced in rabbit IgG fraction of antiserum canine, zebrafish, guinea pig, rabbit, human, mouse, horse, bovine, rat
western blot pricing
SAB2100822 Anti-FLI1 antibody produced in rabbit affinity isolated antibody bovine, zebrafish, human, guinea pig, rabbit, canine, rat, horse, mouse
immunohistochemistry, western blot pricing
SAB4500946 Anti-FLI1 antibody produced in rabbit affinity isolated antibody human, mouse
ELISA, immunohistochemistry, western blot pricing
HPA073099 Anti-FLI1 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody New human
immunofluorescence pricing
SAB2104067 Anti-FLI1, (N-terminal) antibody produced in rabbit affinity isolated antibody, lyophilized powder bovine, horse, chicken, zebrafish, human, mouse, rat, rabbit
western blot pricing
WH0002313M5 Monoclonal Anti-FLI1 antibody produced in mouse clone 1F6, purified immunoglobulin, buffered aqueous solution human
ELISA, immunofluorescence, western blot pricing
SAB4200526 Monoclonal Anti-FLI1 antibody produced in mouse clone F4.23, tissue culture supernatant rat, monkey, bovine, mouse, human, dog
immunofluorescence, western blot pricing
SAB1403830 Monoclonal Anti-FLI1 antibody produced in mouse clone 2G8, purified immunoglobulin, buffered aqueous solution rat, human
ELISA, western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_008026 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_008026 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_008026 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_002017 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_002017 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_002017 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_002017 Rosetta Predictions human pricing
NM_001017381 Rosetta Predictions rat pricing
NM_008026 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_002017 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00247385 predicted 795
2 SASI_Hs02_00333023 predicted 1395
3 SASI_Hs02_00333024 predicted 1895
4 SASI_Hs01_00247387 predicted 905
5 SASI_Hs01_00247388 predicted 1408
6 SASI_Hs01_00247389 predicted 598
7 SASI_Hs01_00247390 predicted 366
8 SASI_Hs01_00247391 predicted 1899
9 SASI_Hs01_00247392 predicted 758
10 SASI_Hs02_00333025 predicted 1312
11 SASI_Hs01_00247384 predicted 745
12 SASI_Hs01_00247386 predicted 1241
13 SASI_Hs01_00247393 predicted 1190
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001017381 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00064389 predicted 843
2 SASI_Rn01_00064390 predicted 477
3 SASI_Rn01_00064391 predicted 700
4 SASI_Rn01_00064392 predicted 1313
5 SASI_Rn01_00064393 predicted 1342
6 SASI_Rn01_00064394 predicted 1387
7 SASI_Rn01_00064395 predicted 1436
8 SASI_Rn01_00064396 predicted 462
9 SASI_Rn01_00064397 predicted 279
10 SASI_Rn02_00202227 predicted 925
11 SASI_Rn01_00064398 predicted 1516
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_008026 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00112716 predicted 588
2 SASI_Mm01_00112717 predicted 600
3 SASI_Mm01_00112718 predicted 730
4 SASI_Mm01_00112719 predicted 1203
5 SASI_Mm01_00112720 predicted 360
6 SASI_Mm01_00112721 predicted 344
7 SASI_Mm01_00112723 predicted 1403
8 SASI_Mm01_00112724 predicted 512
9 SASI_Mm02_00312974 predicted 1290
10 SASI_Mm01_00112725 predicted 632
11 SASI_Mm01_00112722 predicted 1237
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_008026
FLI1 MISSION shRNA Bacterial Glycerol Stock
Fli-1 proto-oncogene, ETS transcription factor
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000436465    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_008026.4-1991s21c1
Sequence:CCGGTATCTTCGGAGGACTCAATTCCTCGAGGAATTGAGTCCTCCGAAGATATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000432268    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008026.4-402s21c1
Sequence:CCGGTGGACTGCAGTGTCAGCAAATCTCGAGATTTGCTGACACTGCAGTCCATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000414426    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008026.4-647s21c1
Sequence:CCGGGATGGCAAGGAATTGTGTAAACTCGAGTTTACACAATTCCTTGCCATCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000417967    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008026.4-1506s21c1
Sequence:CCGGGCAGCTACTACTAGAACTAACCTCGAGGTTAGTTCTAGTAGTAGCTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000042673    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008026.1-446s1c1
Sequence:CCGGCGGGAGTATGACCACATGAATCTCGAGATTCATGTGGTCATACTCCCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000042674    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008026.1-845s1c1
Sequence:CCGGGCCTATAACACAACCTCCCATCTCGAGATGGGAGGTTGTGTTATAGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000042676    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008026.1-1378s1c1
Sequence:CCGGGTACAAGTATCCCTCTGATATCTCGAGATATCAGAGGGATACTTGTACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000042677    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008026.1-686s1c1
Sequence:CCGGGAATACGGATTGATGGAGATTCTCGAGAATCTCCATCAATCCGTATTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000042675    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008026.1-424s1c1
Sequence:CCGGGCCAGTGAGAGTCAATGTCAACTCGAGTTGACATTGACTCTCACTGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_008026
FLI1 MISSION shRNA shRNA Plasmid DNA
Fli-1 proto-oncogene, ETS transcription factor
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000436465    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_008026.4-1991s21c1
Sequence:CCGGTATCTTCGGAGGACTCAATTCCTCGAGGAATTGAGTCCTCCGAAGATATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000432268    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008026.4-402s21c1
Sequence:CCGGTGGACTGCAGTGTCAGCAAATCTCGAGATTTGCTGACACTGCAGTCCATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000414426    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008026.4-647s21c1
Sequence:CCGGGATGGCAAGGAATTGTGTAAACTCGAGTTTACACAATTCCTTGCCATCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000417967    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008026.4-1506s21c1
Sequence:CCGGGCAGCTACTACTAGAACTAACCTCGAGGTTAGTTCTAGTAGTAGCTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000042673    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008026.1-446s1c1
Sequence:CCGGCGGGAGTATGACCACATGAATCTCGAGATTCATGTGGTCATACTCCCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000042674    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008026.1-845s1c1
Sequence:CCGGGCCTATAACACAACCTCCCATCTCGAGATGGGAGGTTGTGTTATAGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000042676    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008026.1-1378s1c1
Sequence:CCGGGTACAAGTATCCCTCTGATATCTCGAGATATCAGAGGGATACTTGTACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000042677    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008026.1-686s1c1
Sequence:CCGGGAATACGGATTGATGGAGATTCTCGAGAATCTCCATCAATCCGTATTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000042675    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008026.1-424s1c1
Sequence:CCGGGCCAGTGAGAGTCAATGTCAACTCGAGTTGACATTGACTCTCACTGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_008026
FLI1 MISSION shRNA Lentiviral Transduction Particles
Fli-1 proto-oncogene, ETS transcription factor
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000436465    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_008026.4-1991s21c1
Sequence:CCGGTATCTTCGGAGGACTCAATTCCTCGAGGAATTGAGTCCTCCGAAGATATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000432268    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008026.4-402s21c1
Sequence:CCGGTGGACTGCAGTGTCAGCAAATCTCGAGATTTGCTGACACTGCAGTCCATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000414426    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008026.4-647s21c1
Sequence:CCGGGATGGCAAGGAATTGTGTAAACTCGAGTTTACACAATTCCTTGCCATCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000417967    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008026.4-1506s21c1
Sequence:CCGGGCAGCTACTACTAGAACTAACCTCGAGGTTAGTTCTAGTAGTAGCTGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000042673    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008026.1-446s1c1
Sequence:CCGGCGGGAGTATGACCACATGAATCTCGAGATTCATGTGGTCATACTCCCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000042674    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008026.1-845s1c1
Sequence:CCGGGCCTATAACACAACCTCCCATCTCGAGATGGGAGGTTGTGTTATAGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000042676    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008026.1-1378s1c1
Sequence:CCGGGTACAAGTATCCCTCTGATATCTCGAGATATCAGAGGGATACTTGTACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000042677    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008026.1-686s1c1
Sequence:CCGGGAATACGGATTGATGGAGATTCTCGAGAATCTCCATCAATCCGTATTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000042675    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008026.1-424s1c1
Sequence:CCGGGCCAGTGAGAGTCAATGTCAACTCGAGTTGACATTGACTCTCACTGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_002017
VALIDATED
FLI1 MISSION shRNA Bacterial Glycerol Stock
Fli-1 proto-oncogene, ETS transcription factor
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000235382    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002017.3-532s21c1
Sequence:CCGGTCAACGTCAAGCGGGAGTATGCTCGAGCATACTCCCGCTTGACGTTGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000235384    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_002017.3-2652s21c1
Sequence:CCGGTATCGAATCAATCGCTGTTATCTCGAGATAACAGCGATTGATTCGATATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000235386    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002017.3-1586s21c1
Sequence:CCGGCTTTGGAGCCGCATCACAATACTCGAGTATTGTGATGCGGCTCCAAAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000235385    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002017.3-1081s21c1
Sequence:CCGGCACAAACGATCAGTAAGAATACTCGAGTATTCTTACTGATCGTTTGTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000235383    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002017.3-930s21c1
Sequence:CCGGAGTTCACTGCTGGCCTATAATCTCGAGATTATAGGCCAGCAGTGAACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000005324    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002017.2-911s1c1
Sequence:CCGGGCACAAACGATCAGTAAGAATCTCGAGATTCTTACTGATCGTTTGTGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000005323    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_002017.2-467s1c1
Sequence:CCGGCCCATGAACTACAACAGCTATCTCGAGATAGCTGTTGTAGTTCATGGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000005325    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: A3
TRC Version: 1 Clone ID:NM_002017.2-1315s1c1
Sequence:CCGGCCCTTCTGACATCTCCTACATCTCGAGATGTAGGAGATGTCAGAAGGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000005322    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.8 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_002017.2-1917s1c1
Sequence:CCGGCGTCATGTTCTGGTTTGAGATCTCGAGATCTCAAACCAGAACATGACGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_002017
VALIDATED
FLI1 MISSION shRNA shRNA Plasmid DNA
Fli-1 proto-oncogene, ETS transcription factor
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000235382    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002017.3-532s21c1
Sequence:CCGGTCAACGTCAAGCGGGAGTATGCTCGAGCATACTCCCGCTTGACGTTGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000235384    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_002017.3-2652s21c1
Sequence:CCGGTATCGAATCAATCGCTGTTATCTCGAGATAACAGCGATTGATTCGATATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000235386    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002017.3-1586s21c1
Sequence:CCGGCTTTGGAGCCGCATCACAATACTCGAGTATTGTGATGCGGCTCCAAAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000235385    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002017.3-1081s21c1
Sequence:CCGGCACAAACGATCAGTAAGAATACTCGAGTATTCTTACTGATCGTTTGTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000235383    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002017.3-930s21c1
Sequence:CCGGAGTTCACTGCTGGCCTATAATCTCGAGATTATAGGCCAGCAGTGAACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000005324    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002017.2-911s1c1
Sequence:CCGGGCACAAACGATCAGTAAGAATCTCGAGATTCTTACTGATCGTTTGTGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000005323    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_002017.2-467s1c1
Sequence:CCGGCCCATGAACTACAACAGCTATCTCGAGATAGCTGTTGTAGTTCATGGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000005325    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: A3
TRC Version: 1 Clone ID:NM_002017.2-1315s1c1
Sequence:CCGGCCCTTCTGACATCTCCTACATCTCGAGATGTAGGAGATGTCAGAAGGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000005322    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.8 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_002017.2-1917s1c1
Sequence:CCGGCGTCATGTTCTGGTTTGAGATCTCGAGATCTCAAACCAGAACATGACGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_002017
VALIDATED
FLI1 MISSION shRNA Lentiviral Transduction Particles
Fli-1 proto-oncogene, ETS transcription factor
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000235382    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002017.3-532s21c1
Sequence:CCGGTCAACGTCAAGCGGGAGTATGCTCGAGCATACTCCCGCTTGACGTTGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000235384    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_002017.3-2652s21c1
Sequence:CCGGTATCGAATCAATCGCTGTTATCTCGAGATAACAGCGATTGATTCGATATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000235386    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002017.3-1586s21c1
Sequence:CCGGCTTTGGAGCCGCATCACAATACTCGAGTATTGTGATGCGGCTCCAAAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000235385    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002017.3-1081s21c1
Sequence:CCGGCACAAACGATCAGTAAGAATACTCGAGTATTCTTACTGATCGTTTGTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000235383    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002017.3-930s21c1
Sequence:CCGGAGTTCACTGCTGGCCTATAATCTCGAGATTATAGGCCAGCAGTGAACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000005324    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002017.2-911s1c1
Sequence:CCGGGCACAAACGATCAGTAAGAATCTCGAGATTCTTACTGATCGTTTGTGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000005323    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_002017.2-467s1c1
Sequence:CCGGCCCATGAACTACAACAGCTATCTCGAGATAGCTGTTGTAGTTCATGGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000005325    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: A3
TRC Version: 1 Clone ID:NM_002017.2-1315s1c1
Sequence:CCGGCCCTTCTGACATCTCCTACATCTCGAGATGTAGGAGATGTCAGAAGGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000005322    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.8 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_002017.2-1917s1c1
Sequence:CCGGCGTCATGTTCTGGTTTGAGATCTCGAGATCTCAAACCAGAACATGACGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)