EMAIL THIS PAGE TO A FRIEND

FLII

flightless I homolog (Drosophila)

Synonyms: FLI FLIL Fli1
UniProtKB ID: Q13045, B4DIL0, F5H407, J3QLG3
Gene ID:
Human(2314) Summary: This gene encodes a protein with a gelsolin-like actin binding domain and an N-terminal leucine-rich repeat-protein protein interaction domain. The protein is similar to a Drosophila protein involved in early embryogenesis and the structural organization of indirect flight muscle. The gene is located within the Smith-Magenis syndrome region on chromosome 17. [provided by RefSeq, Jul 2008]
Mouse(14248) flightless I homolog (Drosophila)
Rat(287375) flightless I homolog (Drosophila)
Zebrafish(560281) flightless I homolog (Drosophila)
chicken(416515) flightless I homolog (Drosophila)
fruit fly(33110) flightless I
domestic cat(101099846) flightless I homolog (Drosophila)
cow(514446) flightless I homolog (Drosophila)
dog(479521) flightless I homolog (Drosophila)
domestic guinea pig(100728597) flightless I homolog (Drosophila)
naked mole-rat(101698091) flightless I homolog (Drosophila)
sheep(101110857) flightless I homolog (Drosophila)
Gene Class: Cytoskeleton
55 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_002018 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_002018 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_002018 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_022009 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_022009 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_022009 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_002018 Rosetta Predictions human pricing
NM_001008279 Rosetta Predictions rat pricing
NM_022009 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_002018 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00143050 predicted 3582
2 SASI_Hs01_00143051 predicted 3503
3 SASI_Hs01_00143052 predicted 1399
4 SASI_Hs01_00143053 predicted 1910
5 SASI_Hs01_00143054 predicted 3564
6 SASI_Hs02_00333026 predicted 2567
7 SASI_Hs01_00143055 predicted 3494
8 SASI_Hs01_00143056 predicted 3468
9 SASI_Hs01_00143058 predicted 3411
10 SASI_Hs01_00143059 predicted 2549
11 SASI_Hs01_00143057 predicted 885
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001008279 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00087998 predicted 2236
2 SASI_Rn02_00198977 predicted 3232
3 SASI_Rn01_00088000 predicted 3437
4 SASI_Rn01_00088001 predicted 3482
5 SASI_Rn02_00198978 predicted 2788
6 SASI_Rn01_00088002 predicted 3190
7 SASI_Rn01_00088004 predicted 261
8 SASI_Rn01_00088005 predicted 2537
9 SASI_Rn01_00088006 predicted 3102
10 SASI_Rn01_00088007 predicted 1468
11 SASI_Rn01_00087999 predicted 3083
12 SASI_Rn01_00088003 predicted 3264
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_022009 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00187916 predicted 2251
2 SASI_Mm01_00187917 predicted 3615
3 SASI_Mm01_00187919 predicted 1521
4 SASI_Mm01_00187920 predicted 944
5 SASI_Mm01_00187921 predicted 1875
6 SASI_Mm02_00326480 predicted 1853
7 SASI_Mm01_00187922 predicted 403
8 SASI_Mm02_00326481 predicted 1852
9 SASI_Mm02_00326482 predicted 3185
10 SASI_Mm01_00187924 predicted 1046
11 SASI_Mm01_00187918 predicted 1958
12 SASI_Mm01_00187923 predicted 1012
13 SASI_Mm01_00187925 predicted 1486
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_002018
VALIDATED
FLII MISSION shRNA Bacterial Glycerol Stock
flightless I homolog (Drosophila)
Human
15 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000156480    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: 293T/17
TRC Version: 1.5 Clone ID:NM_002018.2-1677s1c1
Sequence:CCGGCTGGGAGATCTACTACTGGATCTCGAGATCCAGTAGTAGATCTCCCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000150534    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: 293T/17
TRC Version: 1.5 Clone ID:NM_002018.2-3631s1c1
Sequence:CCGGGACATCATGTTGCTAGACAATCTCGAGATTGTCTAGCAACATGATGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000152063    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_002018.2-3147s1c1
Sequence:CCGGCCATTTCAAGAGGAAGTTCATCTCGAGATGAACTTCCTCTTGAAATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000152827    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_002018.2-3925s1c1
Sequence:CCGGGCAAAGAATGTACTCAGGTGACTCGAGTCACCTGAGTACATTCTTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000153274    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: 293T/17
TRC Version: 1.5 Clone ID:NM_002018.2-1077s1c1
Sequence:CCGGGAGGAAACTTGTCCTGAACAACTCGAGTTGTTCAGGACAAGTTTCCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000153649    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: 293T/17
TRC Version: 1.5 Clone ID:NM_002018.2-3146s1c1
Sequence:CCGGCCCATTTCAAGAGGAAGTTCACTCGAGTGAACTTCCTCTTGAAATGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000157830    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_002018.2-3141s1c1
Sequence:CCGGCCTGTCCCATTTCAAGAGGAACTCGAGTTCCTCTTGAAATGGGACAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000157237    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002018.2-1503s1c1
Sequence:CCGGCCTTGACTACTCCGAGTTCTTCTCGAGAAGAACTCGGAGTAGTCAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000156847    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: 293T/17
TRC Version: 1.5 Clone ID:NM_002018.2-3523s1c1
Sequence:CCGGGCCGAGTACATGAAACACACACTCGAGTGTGTGTTTCATGTACTCGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000157051    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_002018.2-2268s1c1
Sequence:CCGGGCTGCCACAGATCAACTACAACTCGAGTTGTAGTTGATCTGTGGCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000157412    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002018.2-1824s1c1
Sequence:CCGGGCAGGTGTTTGACAACGACATCTCGAGATGTCGTTGTCAAACACCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000343873    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002018.2-1503s21c1
Sequence:CCGGCCTTGACTACTCCGAGTTCTTCTCGAGAAGAACTCGGAGTAGTCAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000343939    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002018.2-3631s21c1
Sequence:CCGGGACATCATGTTGCTAGACAATCTCGAGATTGTCTAGCAACATGATGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000343936    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002018.2-1077s21c1
Sequence:CCGGGAGGAAACTTGTCCTGAACAACTCGAGTTGTTCAGGACAAGTTTCCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000343938    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002018.2-2268s21c1
Sequence:CCGGGCTGCCACAGATCAACTACAACTCGAGTTGTAGTTGATCTGTGGCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_002018
VALIDATED
FLII MISSION shRNA shRNA Plasmid DNA
flightless I homolog (Drosophila)
Human
15 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000156480    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: 293T/17
TRC Version: 1.5 Clone ID:NM_002018.2-1677s1c1
Sequence:CCGGCTGGGAGATCTACTACTGGATCTCGAGATCCAGTAGTAGATCTCCCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000150534    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: 293T/17
TRC Version: 1.5 Clone ID:NM_002018.2-3631s1c1
Sequence:CCGGGACATCATGTTGCTAGACAATCTCGAGATTGTCTAGCAACATGATGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000152063    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_002018.2-3147s1c1
Sequence:CCGGCCATTTCAAGAGGAAGTTCATCTCGAGATGAACTTCCTCTTGAAATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000152827    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_002018.2-3925s1c1
Sequence:CCGGGCAAAGAATGTACTCAGGTGACTCGAGTCACCTGAGTACATTCTTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000153274    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: 293T/17
TRC Version: 1.5 Clone ID:NM_002018.2-1077s1c1
Sequence:CCGGGAGGAAACTTGTCCTGAACAACTCGAGTTGTTCAGGACAAGTTTCCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000153649    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: 293T/17
TRC Version: 1.5 Clone ID:NM_002018.2-3146s1c1
Sequence:CCGGCCCATTTCAAGAGGAAGTTCACTCGAGTGAACTTCCTCTTGAAATGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000157830    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_002018.2-3141s1c1
Sequence:CCGGCCTGTCCCATTTCAAGAGGAACTCGAGTTCCTCTTGAAATGGGACAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000157237    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002018.2-1503s1c1
Sequence:CCGGCCTTGACTACTCCGAGTTCTTCTCGAGAAGAACTCGGAGTAGTCAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000156847    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: 293T/17
TRC Version: 1.5 Clone ID:NM_002018.2-3523s1c1
Sequence:CCGGGCCGAGTACATGAAACACACACTCGAGTGTGTGTTTCATGTACTCGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000157051    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_002018.2-2268s1c1
Sequence:CCGGGCTGCCACAGATCAACTACAACTCGAGTTGTAGTTGATCTGTGGCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000157412    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002018.2-1824s1c1
Sequence:CCGGGCAGGTGTTTGACAACGACATCTCGAGATGTCGTTGTCAAACACCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000343873    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002018.2-1503s21c1
Sequence:CCGGCCTTGACTACTCCGAGTTCTTCTCGAGAAGAACTCGGAGTAGTCAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000343939    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002018.2-3631s21c1
Sequence:CCGGGACATCATGTTGCTAGACAATCTCGAGATTGTCTAGCAACATGATGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000343936    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002018.2-1077s21c1
Sequence:CCGGGAGGAAACTTGTCCTGAACAACTCGAGTTGTTCAGGACAAGTTTCCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000343938    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002018.2-2268s21c1
Sequence:CCGGGCTGCCACAGATCAACTACAACTCGAGTTGTAGTTGATCTGTGGCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_002018
VALIDATED
FLII MISSION shRNA Lentiviral Transduction Particles
flightless I homolog (Drosophila)
Human
15 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000156480    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: 293T/17
TRC Version: 1.5 Clone ID:NM_002018.2-1677s1c1
Sequence:CCGGCTGGGAGATCTACTACTGGATCTCGAGATCCAGTAGTAGATCTCCCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000150534    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: 293T/17
TRC Version: 1.5 Clone ID:NM_002018.2-3631s1c1
Sequence:CCGGGACATCATGTTGCTAGACAATCTCGAGATTGTCTAGCAACATGATGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000152063    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_002018.2-3147s1c1
Sequence:CCGGCCATTTCAAGAGGAAGTTCATCTCGAGATGAACTTCCTCTTGAAATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000152827    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_002018.2-3925s1c1
Sequence:CCGGGCAAAGAATGTACTCAGGTGACTCGAGTCACCTGAGTACATTCTTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000153274    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: 293T/17
TRC Version: 1.5 Clone ID:NM_002018.2-1077s1c1
Sequence:CCGGGAGGAAACTTGTCCTGAACAACTCGAGTTGTTCAGGACAAGTTTCCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000153649    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: 293T/17
TRC Version: 1.5 Clone ID:NM_002018.2-3146s1c1
Sequence:CCGGCCCATTTCAAGAGGAAGTTCACTCGAGTGAACTTCCTCTTGAAATGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000157830    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_002018.2-3141s1c1
Sequence:CCGGCCTGTCCCATTTCAAGAGGAACTCGAGTTCCTCTTGAAATGGGACAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000157237    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002018.2-1503s1c1
Sequence:CCGGCCTTGACTACTCCGAGTTCTTCTCGAGAAGAACTCGGAGTAGTCAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000156847    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: 293T/17
TRC Version: 1.5 Clone ID:NM_002018.2-3523s1c1
Sequence:CCGGGCCGAGTACATGAAACACACACTCGAGTGTGTGTTTCATGTACTCGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000157051    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_002018.2-2268s1c1
Sequence:CCGGGCTGCCACAGATCAACTACAACTCGAGTTGTAGTTGATCTGTGGCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000157412    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002018.2-1824s1c1
Sequence:CCGGGCAGGTGTTTGACAACGACATCTCGAGATGTCGTTGTCAAACACCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000343873    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002018.2-1503s21c1
Sequence:CCGGCCTTGACTACTCCGAGTTCTTCTCGAGAAGAACTCGGAGTAGTCAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000343939    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002018.2-3631s21c1
Sequence:CCGGGACATCATGTTGCTAGACAATCTCGAGATTGTCTAGCAACATGATGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000343936    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002018.2-1077s21c1
Sequence:CCGGGAGGAAACTTGTCCTGAACAACTCGAGTTGTTCAGGACAAGTTTCCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000343938    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002018.2-2268s21c1
Sequence:CCGGGCTGCCACAGATCAACTACAACTCGAGTTGTAGTTGATCTGTGGCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_022009
FLII MISSION shRNA Bacterial Glycerol Stock
flightless I homolog (Drosophila)
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000108872    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022009.1-2023s1c1
Sequence:CCGGCCACACTGAGTAACACGACTACTCGAGTAGTCGTGTTACTCAGTGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000108870    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_022009.1-3850s1c1
Sequence:CCGGCAGTACCTATGACCTCAGACTCTCGAGAGTCTGAGGTCATAGGTACTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000108871    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022009.1-1193s1c1
Sequence:CCGGCGAGTGGTACAACATTGACTTCTCGAGAAGTCAATGTTGTACCACTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000108874    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022009.1-1002s1c1
Sequence:CCGGGCTGCCAACAACAACCTAGAACTCGAGTTCTAGGTTGTTGTTGGCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000108873    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022009.1-1484s1c1
Sequence:CCGGCCTTGACTACTCGGAGTTCTTCTCGAGAAGAACTCCGAGTAGTCAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000353867    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022009.1-2023s21c1
Sequence:CCGGCCACACTGAGTAACACGACTACTCGAGTAGTCGTGTTACTCAGTGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000324345    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022009.1-1484s21c1
Sequence:CCGGCCTTGACTACTCGGAGTTCTTCTCGAGAAGAACTCCGAGTAGTCAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000324413    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022009.1-1193s21c1
Sequence:CCGGCGAGTGGTACAACATTGACTTCTCGAGAAGTCAATGTTGTACCACTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000324412    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022009.1-1002s21c1
Sequence:CCGGGCTGCCAACAACAACCTAGAACTCGAGTTCTAGGTTGTTGTTGGCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_022009
FLII MISSION shRNA shRNA Plasmid DNA
flightless I homolog (Drosophila)
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000108872    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022009.1-2023s1c1
Sequence:CCGGCCACACTGAGTAACACGACTACTCGAGTAGTCGTGTTACTCAGTGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000108870    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_022009.1-3850s1c1
Sequence:CCGGCAGTACCTATGACCTCAGACTCTCGAGAGTCTGAGGTCATAGGTACTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000108871    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022009.1-1193s1c1
Sequence:CCGGCGAGTGGTACAACATTGACTTCTCGAGAAGTCAATGTTGTACCACTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000108874    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022009.1-1002s1c1
Sequence:CCGGGCTGCCAACAACAACCTAGAACTCGAGTTCTAGGTTGTTGTTGGCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000108873    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022009.1-1484s1c1
Sequence:CCGGCCTTGACTACTCGGAGTTCTTCTCGAGAAGAACTCCGAGTAGTCAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000353867    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022009.1-2023s21c1
Sequence:CCGGCCACACTGAGTAACACGACTACTCGAGTAGTCGTGTTACTCAGTGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000324345    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022009.1-1484s21c1
Sequence:CCGGCCTTGACTACTCGGAGTTCTTCTCGAGAAGAACTCCGAGTAGTCAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000324413    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022009.1-1193s21c1
Sequence:CCGGCGAGTGGTACAACATTGACTTCTCGAGAAGTCAATGTTGTACCACTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000324412    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022009.1-1002s21c1
Sequence:CCGGGCTGCCAACAACAACCTAGAACTCGAGTTCTAGGTTGTTGTTGGCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_022009
FLII MISSION shRNA Lentiviral Transduction Particles
flightless I homolog (Drosophila)
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000108872    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022009.1-2023s1c1
Sequence:CCGGCCACACTGAGTAACACGACTACTCGAGTAGTCGTGTTACTCAGTGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000108870    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_022009.1-3850s1c1
Sequence:CCGGCAGTACCTATGACCTCAGACTCTCGAGAGTCTGAGGTCATAGGTACTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000108871    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022009.1-1193s1c1
Sequence:CCGGCGAGTGGTACAACATTGACTTCTCGAGAAGTCAATGTTGTACCACTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000108874    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022009.1-1002s1c1
Sequence:CCGGGCTGCCAACAACAACCTAGAACTCGAGTTCTAGGTTGTTGTTGGCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000108873    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022009.1-1484s1c1
Sequence:CCGGCCTTGACTACTCGGAGTTCTTCTCGAGAAGAACTCCGAGTAGTCAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000353867    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022009.1-2023s21c1
Sequence:CCGGCCACACTGAGTAACACGACTACTCGAGTAGTCGTGTTACTCAGTGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000324345    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022009.1-1484s21c1
Sequence:CCGGCCTTGACTACTCGGAGTTCTTCTCGAGAAGAACTCCGAGTAGTCAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000324413    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022009.1-1193s21c1
Sequence:CCGGCGAGTGGTACAACATTGACTTCTCGAGAAGTCAATGTTGTACCACTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000324412    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022009.1-1002s21c1
Sequence:CCGGGCTGCCAACAACAACCTAGAACTCGAGTTCTAGGTTGTTGTTGGCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks