EMAIL THIS PAGE TO A FRIEND

FLJ11292

Gene Product Result for
Species: Human FLJ11292(55338)
Gene ID:
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_018382
FLJ11292 MISSION shRNA Bacterial Glycerol Stock
Human
6 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000150085    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018382.1-305s1c1
Sequence:CCGGCATTTCCTACTAAAGTACCCACTCGAGTGGGTACTTTAGTAGGAAATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000148529    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018382.1-311s1c1
Sequence:CCGGCTACTAAAGTACCCAGCTCATCTCGAGATGAGCTGGGTACTTTAGTAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000131217    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_018382.1-243s1c1
Sequence:CCGGGAATAGGAACAGCTCTGCTCTCTCGAGAGAGCAGAGCTGTTCCTATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000127836    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_018382.1-1716s1c1
Sequence:CCGGGCATGTTCTAACCCAATGCAACTCGAGTTGCATTGGGTTAGAACATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000131153    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_018382.1-1092s1c1
Sequence:CCGGGCACAGCTTCAGGACACTTAACTCGAGTTAAGTGTCCTGAAGCTGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000130890    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_018382.1-851s1c1
Sequence:CCGGGCCATTACTGAGGCTTGATTACTCGAGTAATCAAGCCTCAGTAATGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_018382
FLJ11292 MISSION shRNA shRNA Plasmid DNA
Human
6 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000150085    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018382.1-305s1c1
Sequence:CCGGCATTTCCTACTAAAGTACCCACTCGAGTGGGTACTTTAGTAGGAAATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000148529    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018382.1-311s1c1
Sequence:CCGGCTACTAAAGTACCCAGCTCATCTCGAGATGAGCTGGGTACTTTAGTAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000131217    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_018382.1-243s1c1
Sequence:CCGGGAATAGGAACAGCTCTGCTCTCTCGAGAGAGCAGAGCTGTTCCTATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000127836    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_018382.1-1716s1c1
Sequence:CCGGGCATGTTCTAACCCAATGCAACTCGAGTTGCATTGGGTTAGAACATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000131153    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_018382.1-1092s1c1
Sequence:CCGGGCACAGCTTCAGGACACTTAACTCGAGTTAAGTGTCCTGAAGCTGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000130890    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_018382.1-851s1c1
Sequence:CCGGGCCATTACTGAGGCTTGATTACTCGAGTAATCAAGCCTCAGTAATGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_018382
FLJ11292 MISSION shRNA Lentiviral Transduction Particles
Human
6 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000150085    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018382.1-305s1c1
Sequence:CCGGCATTTCCTACTAAAGTACCCACTCGAGTGGGTACTTTAGTAGGAAATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000148529    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018382.1-311s1c1
Sequence:CCGGCTACTAAAGTACCCAGCTCATCTCGAGATGAGCTGGGTACTTTAGTAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000131217    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_018382.1-243s1c1
Sequence:CCGGGAATAGGAACAGCTCTGCTCTCTCGAGAGAGCAGAGCTGTTCCTATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000127836    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_018382.1-1716s1c1
Sequence:CCGGGCATGTTCTAACCCAATGCAACTCGAGTTGCATTGGGTTAGAACATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000131153    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_018382.1-1092s1c1
Sequence:CCGGGCACAGCTTCAGGACACTTAACTCGAGTTAAGTGTCCTGAAGCTGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000130890    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_018382.1-851s1c1
Sequence:CCGGGCCATTACTGAGGCTTGATTACTCGAGTAATCAAGCCTCAGTAATGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks