EMAIL THIS PAGE TO A FRIEND

FLJ13197

42 Gene Product Result for
Species: Human FLJ13197(79667)
Gene ID:
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_024614 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_024614 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_024614 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_024614 Rosetta Predictions human pricing
XR_040784 Rosetta Predictions human pricing
XR_040785 Rosetta Predictions human pricing
XR_040786 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_024614 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00217859 predicted 569
2 SASI_Hs01_00217860 predicted 736
3 SASI_Hs01_00217861 predicted 587
4 SASI_Hs01_00217862 predicted 783
5 SASI_Hs01_00217863 predicted 821
6 SASI_Hs01_00217864 predicted 578
7 SASI_Hs01_00217865 predicted 828
8 SASI_Hs01_00217866 predicted 745
9 SASI_Hs01_00217867 predicted 568
10 SASI_Hs01_00217868 predicted 589
siRNA
PRODUCT # siRNA Type ? SPECIES
XR_040784 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00521901 predicted 1107
2 SASI_Hs02_00521902 predicted 1077
3 SASI_Hs02_00521903 predicted 1160
4 SASI_Hs02_00521904 predicted 972
5 SASI_Hs02_00521905 predicted 1161
6 SASI_Hs02_00521906 predicted 1128
7 SASI_Hs02_00521907 predicted 981
8 SASI_Hs02_00521908 predicted 1127
9 SASI_Hs02_00521909 predicted 1072
10 SASI_Hs02_00521910 predicted 1179
siRNA
PRODUCT # siRNA Type ? SPECIES
XR_040785 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00521911 predicted 1111
2 SASI_Hs02_00521912 predicted 1077
3 SASI_Hs02_00521913 predicted 1162
4 SASI_Hs02_00521914 predicted 975
5 SASI_Hs02_00521915 predicted 1162
6 SASI_Hs02_00521916 predicted 1131
7 SASI_Hs02_00521917 predicted 975
8 SASI_Hs02_00521918 predicted 1124
9 SASI_Hs02_00521919 predicted 1073
10 SASI_Hs02_00521920 predicted 1177
siRNA
PRODUCT # siRNA Type ? SPECIES
XR_040786 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00521921 predicted 1109
2 SASI_Hs02_00521922 predicted 1074
3 SASI_Hs02_00521923 predicted 1161
4 SASI_Hs02_00521924 predicted 980
5 SASI_Hs02_00521925 predicted 1165
6 SASI_Hs02_00521926 predicted 1124
7 SASI_Hs02_00521927 predicted 974
8 SASI_Hs02_00521928 predicted 1122
9 SASI_Hs02_00521929 predicted 1074
10 SASI_Hs02_00521930 predicted 1174
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_024614
FLJ13197 MISSION shRNA Bacterial Glycerol Stock
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000168147    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_024614.1-473s1c1
Sequence:CCGGCCAGTATTCTTGGATGCAGAACTCGAGTTCTGCATCCAAGAATACTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000167453    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_024614.1-453s1c1
Sequence:CCGGGAGAATAACTTGTCTGACTACCTCGAGGTAGTCAGACAAGTTATTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000167713    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_024614.1-455s1c1
Sequence:CCGGGAATAACTTGTCTGACTACCACTCGAGTGGTAGTCAGACAAGTTATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000172484    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_024614.1-732s1c1
Sequence:CCGGCCTCAGAATCTACTGGCTGAACTCGAGTTCAGCCAGTAGATTCTGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000168661    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_024614.1-545s1c1
Sequence:CCGGGCTCAGAACAAGAACTGAGATCTCGAGATCTCAGTTCTTGTTCTGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_024614
FLJ13197 MISSION shRNA shRNA Plasmid DNA
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000168147    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_024614.1-473s1c1
Sequence:CCGGCCAGTATTCTTGGATGCAGAACTCGAGTTCTGCATCCAAGAATACTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000167453    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_024614.1-453s1c1
Sequence:CCGGGAGAATAACTTGTCTGACTACCTCGAGGTAGTCAGACAAGTTATTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000167713    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_024614.1-455s1c1
Sequence:CCGGGAATAACTTGTCTGACTACCACTCGAGTGGTAGTCAGACAAGTTATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000172484    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_024614.1-732s1c1
Sequence:CCGGCCTCAGAATCTACTGGCTGAACTCGAGTTCAGCCAGTAGATTCTGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000168661    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_024614.1-545s1c1
Sequence:CCGGGCTCAGAACAAGAACTGAGATCTCGAGATCTCAGTTCTTGTTCTGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_024614
FLJ13197 MISSION shRNA Lentiviral Transduction Particles
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000168147    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_024614.1-473s1c1
Sequence:CCGGCCAGTATTCTTGGATGCAGAACTCGAGTTCTGCATCCAAGAATACTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000167453    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_024614.1-453s1c1
Sequence:CCGGGAGAATAACTTGTCTGACTACCTCGAGGTAGTCAGACAAGTTATTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000167713    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_024614.1-455s1c1
Sequence:CCGGGAATAACTTGTCTGACTACCACTCGAGTGGTAGTCAGACAAGTTATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000172484    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_024614.1-732s1c1
Sequence:CCGGCCTCAGAATCTACTGGCTGAACTCGAGTTCAGCCAGTAGATTCTGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000168661    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_024614.1-545s1c1
Sequence:CCGGGCTCAGAACAAGAACTGAGATCTCGAGATCTCAGTTCTTGTTCTGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks