EMAIL THIS PAGE TO A FRIEND

FLJ16124

62 Gene Product Result for
Species: Human FLJ16124(440867)
Gene ID:
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001004345 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001004345 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001004345 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001004345 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001004345 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00153818 predicted 476
2 SASI_Hs01_00153819 predicted 637
3 SASI_Hs01_00153820 predicted 673
4 SASI_Hs01_00153821 predicted 118
5 SASI_Hs01_00153822 predicted 789
6 SASI_Hs01_00153823 predicted 471
7 SASI_Hs01_00153824 predicted 673
8 SASI_Hs01_00153825 predicted 444
9 SASI_Hs01_00153826 predicted 719
10 SASI_Hs01_00153827 predicted 797
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001004345
FLJ16124 MISSION shRNA Bacterial Glycerol Stock
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000138864    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001004345.1-264s1c1
Sequence:CCGGGAATACAGGTTGGAGTGCAGTCTCGAGACTGCACTCCAACCTGTATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000135349    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001004345.1-375s1c1
Sequence:CCGGGTTGTATGGATGTACCACTGTCTCGAGACAGTGGTACATCCATACAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000134859    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001004345.1-356s1c1
Sequence:CCGGCCTTCACGAGAAATATTACGTCTCGAGACGTAATATTTCTCGTGAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000133968    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001004345.1-510s1c1
Sequence:CCGGCCAGAAGTTAAGAAGAGCAAACTCGAGTTTGCTCTTCTTAACTTCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000134221    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001004345.1-398s1c1
Sequence:CCGGGTTTATCCATTCTTCAGGTGACTCGAGTCACCTGAAGAATGGATAAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000135033    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001004345.1-327s1c1
Sequence:CCGGCTTGCTGACTTCAAGAATGAACTCGAGTTCATTCTTGAAGTCAGCAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000138456    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001004345.1-335s1c1
Sequence:CCGGCTTCAAGAATGAAGCCACGGACTCGAGTCCGTGGCTTCATTCTTGAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000138167    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001004345.1-259s1c1
Sequence:CCGGGCTGTGAATACAGGTTGGAGTCTCGAGACTCCAACCTGTATTCACAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000138457    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001004345.1-404s1c1
Sequence:CCGGCCATTCTTCAGGTGAAGGACACTCGAGTGTCCTTCACCTGAAGAATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001004345
FLJ16124 MISSION shRNA shRNA Plasmid DNA
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000138864    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001004345.1-264s1c1
Sequence:CCGGGAATACAGGTTGGAGTGCAGTCTCGAGACTGCACTCCAACCTGTATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000135349    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001004345.1-375s1c1
Sequence:CCGGGTTGTATGGATGTACCACTGTCTCGAGACAGTGGTACATCCATACAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000134859    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001004345.1-356s1c1
Sequence:CCGGCCTTCACGAGAAATATTACGTCTCGAGACGTAATATTTCTCGTGAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000133968    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001004345.1-510s1c1
Sequence:CCGGCCAGAAGTTAAGAAGAGCAAACTCGAGTTTGCTCTTCTTAACTTCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000134221    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001004345.1-398s1c1
Sequence:CCGGGTTTATCCATTCTTCAGGTGACTCGAGTCACCTGAAGAATGGATAAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000135033    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001004345.1-327s1c1
Sequence:CCGGCTTGCTGACTTCAAGAATGAACTCGAGTTCATTCTTGAAGTCAGCAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000138456    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001004345.1-335s1c1
Sequence:CCGGCTTCAAGAATGAAGCCACGGACTCGAGTCCGTGGCTTCATTCTTGAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000138167    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001004345.1-259s1c1
Sequence:CCGGGCTGTGAATACAGGTTGGAGTCTCGAGACTCCAACCTGTATTCACAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000138457    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001004345.1-404s1c1
Sequence:CCGGCCATTCTTCAGGTGAAGGACACTCGAGTGTCCTTCACCTGAAGAATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001004345
FLJ16124 MISSION shRNA Lentiviral Transduction Particles
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000138864    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001004345.1-264s1c1
Sequence:CCGGGAATACAGGTTGGAGTGCAGTCTCGAGACTGCACTCCAACCTGTATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000135349    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001004345.1-375s1c1
Sequence:CCGGGTTGTATGGATGTACCACTGTCTCGAGACAGTGGTACATCCATACAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000134859    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001004345.1-356s1c1
Sequence:CCGGCCTTCACGAGAAATATTACGTCTCGAGACGTAATATTTCTCGTGAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000133968    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001004345.1-510s1c1
Sequence:CCGGCCAGAAGTTAAGAAGAGCAAACTCGAGTTTGCTCTTCTTAACTTCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000134221    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001004345.1-398s1c1
Sequence:CCGGGTTTATCCATTCTTCAGGTGACTCGAGTCACCTGAAGAATGGATAAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000135033    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001004345.1-327s1c1
Sequence:CCGGCTTGCTGACTTCAAGAATGAACTCGAGTTCATTCTTGAAGTCAGCAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000138456    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001004345.1-335s1c1
Sequence:CCGGCTTCAAGAATGAAGCCACGGACTCGAGTCCGTGGCTTCATTCTTGAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000138167    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001004345.1-259s1c1
Sequence:CCGGGCTGTGAATACAGGTTGGAGTCTCGAGACTCCAACCTGTATTCACAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000138457    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001004345.1-404s1c1
Sequence:CCGGCCATTCTTCAGGTGAAGGACACTCGAGTGTCCTTCACCTGAAGAATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks