EMAIL THIS PAGE TO A FRIEND

FLJ16171

Species: Human FLJ16171(441116)
Gene ID:
10 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001004348 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001004348 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001004348 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001004348 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001004348 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00086220 predicted 1880
2 SASI_Hs01_00086221 predicted 1287
3 SASI_Hs01_00086222 predicted 1751
4 SASI_Hs01_00086223 predicted 2070
5 SASI_Hs01_00086224 predicted 1305
6 SASI_Hs01_00086225 predicted 1331
7 SASI_Hs01_00086226 predicted 1280
8 SASI_Hs01_00086227 predicted 1236
9 SASI_Hs01_00086228 predicted 1734
10 SASI_Hs01_00086229 predicted 1633
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001004348
FLJ16171 MISSION shRNA Bacterial Glycerol Stock
Human
6 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000143400    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001004348.1-360s1c1
Sequence:CCGGCATGTTGAGGTTCTTTGGGATCTCGAGATCCCAAAGAACCTCAACATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000141063    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001004348.1-236s1c1
Sequence:CCGGCAGTGTTGACAGTGATGCCTTCTCGAGAAGGCATCACTGTCAACACTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000141091    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001004348.1-504s1c1
Sequence:CCGGCCTGAGTTTCAGACTGCCTTTCTCGAGAAAGGCAGTCTGAAACTCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000122737    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001004348.1-121s1c1
Sequence:CCGGCCCAACATCTGCGCCCTTGTACTCGAGTACAAGGGCGCAGATGTTGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000122192    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001004348.1-1853s1c1
Sequence:CCGGGCTTTGAAAGAATGGACTATTCTCGAGAATAGTCCATTCTTTCAAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000122294    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001004348.1-297s1c1
Sequence:CCGGCCTAGAGTTTGTCACCCTCTTCTCGAGAAGAGGGTGACAAACTCTAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001004348
FLJ16171 MISSION shRNA shRNA Plasmid DNA
Human
6 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000143400    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001004348.1-360s1c1
Sequence:CCGGCATGTTGAGGTTCTTTGGGATCTCGAGATCCCAAAGAACCTCAACATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000141063    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001004348.1-236s1c1
Sequence:CCGGCAGTGTTGACAGTGATGCCTTCTCGAGAAGGCATCACTGTCAACACTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000141091    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001004348.1-504s1c1
Sequence:CCGGCCTGAGTTTCAGACTGCCTTTCTCGAGAAAGGCAGTCTGAAACTCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000122737    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001004348.1-121s1c1
Sequence:CCGGCCCAACATCTGCGCCCTTGTACTCGAGTACAAGGGCGCAGATGTTGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000122192    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001004348.1-1853s1c1
Sequence:CCGGGCTTTGAAAGAATGGACTATTCTCGAGAATAGTCCATTCTTTCAAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000122294    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001004348.1-297s1c1
Sequence:CCGGCCTAGAGTTTGTCACCCTCTTCTCGAGAAGAGGGTGACAAACTCTAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001004348
FLJ16171 MISSION shRNA Lentiviral Transduction Particles
Human
6 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000143400    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001004348.1-360s1c1
Sequence:CCGGCATGTTGAGGTTCTTTGGGATCTCGAGATCCCAAAGAACCTCAACATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000141063    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001004348.1-236s1c1
Sequence:CCGGCAGTGTTGACAGTGATGCCTTCTCGAGAAGGCATCACTGTCAACACTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000141091    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001004348.1-504s1c1
Sequence:CCGGCCTGAGTTTCAGACTGCCTTTCTCGAGAAAGGCAGTCTGAAACTCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000122737    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001004348.1-121s1c1
Sequence:CCGGCCCAACATCTGCGCCCTTGTACTCGAGTACAAGGGCGCAGATGTTGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000122192    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001004348.1-1853s1c1
Sequence:CCGGGCTTTGAAAGAATGGACTATTCTCGAGAATAGTCCATTCTTTCAAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000122294    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001004348.1-297s1c1
Sequence:CCGGCCTAGAGTTTGTCACCCTCTTCTCGAGAAGAGGGTGACAAACTCTAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks