EMAIL THIS PAGE TO A FRIEND

FLJ25363

32 Gene Product Result for
Species: Human FLJ25363(401082)
Gene ID:
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001145553 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001145553 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001145553 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
XM_001720720 Rosetta Predictions human pricing
XM_001721742 Rosetta Predictions human pricing
XM_001722154 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001720720 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00438455 predicted 410
2 SASI_Hs02_00438456 predicted 442
3 SASI_Hs02_00438457 predicted 435
4 SASI_Hs02_00438458 predicted 449
5 SASI_Hs02_00438459 predicted 342
6 SASI_Hs02_00438460 predicted 1087
7 SASI_Hs02_00438461 predicted 1030
8 SASI_Hs02_00438462 predicted 1158
9 SASI_Hs02_00438463 predicted 1160
10 SASI_Hs02_00438464 predicted 1026
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001721742 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00444762 predicted 450
2 SASI_Hs02_00444763 predicted 415
3 SASI_Hs02_00444764 predicted 432
4 SASI_Hs02_00444765 predicted 450
5 SASI_Hs02_00444766 predicted 396
6 SASI_Hs02_00444767 predicted 344
7 SASI_Hs02_00444768 predicted 1084
8 SASI_Hs02_00444769 predicted 1026
9 SASI_Hs02_00444770 predicted 1155
10 SASI_Hs02_00444771 predicted 1163
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001722154 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00447505 predicted 410
2 SASI_Hs02_00447506 predicted 448
3 SASI_Hs02_00447507 predicted 436
4 SASI_Hs02_00447508 predicted 447
5 SASI_Hs02_00447509 predicted 344
6 SASI_Hs02_00447510 predicted 1086
7 SASI_Hs02_00447511 predicted 1028
8 SASI_Hs02_00447512 predicted 1161
9 SASI_Hs02_00447513 predicted 1163
10 SASI_Hs02_00447514 predicted 1026
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001145553
FLJ25363 MISSION shRNA Bacterial Glycerol Stock
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000351006    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001145553.1-214s21c1
Sequence:CCGGCTTGAGGACGGGTCGCATTATCTCGAGATAATGCGACCCGTCCTCAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000338947    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001145553.1-404s21c1
Sequence:CCGGTCACAATTTCACCACATAAATCTCGAGATTTATGTGGTGAAATTGTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000338949    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001145553.1-452s21c1
Sequence:CCGGGTGGATTAAAGTGATTCATATCTCGAGATATGAATCACTTTAATCCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000338948    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001145553.1-365s21c1
Sequence:CCGGATGCTTGGCACAAGGTGTTTACTCGAGTAAACACCTTGTGCCAAGCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000338946    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001145553.1-641s21c1
Sequence:CCGGTGGTACAAGAGGGAGATTAATCTCGAGATTAATCTCCCTCTTGTACCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001145553
FLJ25363 MISSION shRNA shRNA Plasmid DNA
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000351006    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001145553.1-214s21c1
Sequence:CCGGCTTGAGGACGGGTCGCATTATCTCGAGATAATGCGACCCGTCCTCAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000338947    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001145553.1-404s21c1
Sequence:CCGGTCACAATTTCACCACATAAATCTCGAGATTTATGTGGTGAAATTGTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000338949    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001145553.1-452s21c1
Sequence:CCGGGTGGATTAAAGTGATTCATATCTCGAGATATGAATCACTTTAATCCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000338948    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001145553.1-365s21c1
Sequence:CCGGATGCTTGGCACAAGGTGTTTACTCGAGTAAACACCTTGTGCCAAGCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000338946    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001145553.1-641s21c1
Sequence:CCGGTGGTACAAGAGGGAGATTAATCTCGAGATTAATCTCCCTCTTGTACCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001145553
FLJ25363 MISSION shRNA Lentiviral Transduction Particles
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000351006    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001145553.1-214s21c1
Sequence:CCGGCTTGAGGACGGGTCGCATTATCTCGAGATAATGCGACCCGTCCTCAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000338947    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001145553.1-404s21c1
Sequence:CCGGTCACAATTTCACCACATAAATCTCGAGATTTATGTGGTGAAATTGTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000338949    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001145553.1-452s21c1
Sequence:CCGGGTGGATTAAAGTGATTCATATCTCGAGATATGAATCACTTTAATCCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000338948    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001145553.1-365s21c1
Sequence:CCGGATGCTTGGCACAAGGTGTTTACTCGAGTAAACACCTTGTGCCAAGCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000338946    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001145553.1-641s21c1
Sequence:CCGGTGGTACAAGAGGGAGATTAATCTCGAGATTAATCTCCCTCTTGTACCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks