EMAIL THIS PAGE TO A FRIEND

FLJ25715

10 Gene Product Result for
Species: Human FLJ25715(284241)
Gene ID:
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_182570 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_182570 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_182570 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_182570 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_182570 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00183462 predicted 283
2 SASI_Hs01_00183463 predicted 504
3 SASI_Hs01_00183464 predicted 308
4 SASI_Hs01_00183465 predicted 221
5 SASI_Hs01_00183466 predicted 405
6 SASI_Hs01_00183467 predicted 523
7 SASI_Hs01_00183468 predicted 419
8 SASI_Hs01_00183469 predicted 293
9 SASI_Hs01_00183470 predicted 221
10 SASI_Hs01_00183471 predicted 521
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_182570
FLJ25715 MISSION shRNA Bacterial Glycerol Stock
Human
1 Products Total
TRC Number Price Set Price (1)? Select
TRCN0000122771    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_182570.1-319s1c1
Sequence:CCGGCGCGAGCCGTTCTCCTCCACTCTCGAGAGTGGAGGAGAACGGCTCGCGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_182570
FLJ25715 MISSION shRNA shRNA Plasmid DNA
Human
1 Products Total
TRC Number Vector Price Set Price (1)? Select
TRCN0000122771    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_182570.1-319s1c1
Sequence:CCGGCGCGAGCCGTTCTCCTCCACTCTCGAGAGTGGAGGAGAACGGCTCGCGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_182570
FLJ25715 MISSION shRNA Lentiviral Transduction Particles
Human
1 Products Total
TRC Number Volume Titer Vector Price Set Price (1)? Select
TRCN0000122771    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_182570.1-319s1c1
Sequence:CCGGCGCGAGCCGTTCTCCTCCACTCTCGAGAGTGGAGGAGAACGGCTCGCGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)