EMAIL THIS PAGE TO A FRIEND

FLJ25758

38 Gene Product Result for
Species: Human FLJ25758(497049)
Gene ID:
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001011541 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001011541 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001011541 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001011541 Rosetta Predictions human pricing
XR_040427 Rosetta Predictions human pricing
XR_040428 Rosetta Predictions human pricing
XR_040429 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001011541 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00050434 predicted 960
2 SASI_Hs01_00050435 predicted 817
3 SASI_Hs01_00050436 predicted 859
4 SASI_Hs01_00050437 predicted 1009
5 SASI_Hs01_00050438 predicted 996
6 SASI_Hs01_00050439 predicted 820
siRNA
PRODUCT # siRNA Type ? SPECIES
XR_040427 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00518771 predicted 274
2 SASI_Hs02_00518772 predicted 270
3 SASI_Hs02_00518773 predicted 9
4 SASI_Hs02_00518774 predicted 271
5 SASI_Hs02_00518775 predicted 303
6 SASI_Hs02_00518776 predicted 390
7 SASI_Hs02_00518777 predicted 389
8 SASI_Hs02_00518778 predicted 410
9 SASI_Hs02_00518779 predicted 538
10 SASI_Hs02_00518780 predicted 251
siRNA
PRODUCT # siRNA Type ? SPECIES
XR_040428 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00518781 predicted 276
2 SASI_Hs02_00518782 predicted 271
3 SASI_Hs02_00518783 predicted 5
4 SASI_Hs02_00518784 predicted 273
5 SASI_Hs02_00518785 predicted 304
6 SASI_Hs02_00518786 predicted 390
7 SASI_Hs02_00518787 predicted 393
8 SASI_Hs02_00518788 predicted 407
9 SASI_Hs02_00518789 predicted 539
10 SASI_Hs02_00518790 predicted 245
siRNA
PRODUCT # siRNA Type ? SPECIES
XR_040429 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00518791 predicted 273
2 SASI_Hs02_00518792 predicted 271
3 SASI_Hs02_00518793 predicted 7
4 SASI_Hs02_00518794 predicted 269
5 SASI_Hs02_00518795 predicted 297
6 SASI_Hs02_00518796 predicted 395
7 SASI_Hs02_00518797 predicted 538
8 SASI_Hs02_00518798 predicted 407
9 SASI_Hs02_00518799 predicted 251
10 SASI_Hs02_00518800 predicted 203
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001011541
FLJ25758 MISSION shRNA Bacterial Glycerol Stock
Human
4 Products Total
TRC Number Price Set Price (4)? Select
TRCN0000181153    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001011541.1-365s1c1
Sequence:CCGGCTGATGATCATAGGCTCCTCACTCGAGTGAGGAGCCTATGATCATCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000180575    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001011541.1-352s1c1
Sequence:CCGGGAGGAGTCCCTTACTGATGATCTCGAGATCATCAGTAAGGGACTCCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000179580    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001011541.1-588s1c1
Sequence:CCGGGCTGTTCCTAGTCATGGATTACTCGAGTAATCCATGACTAGGAACAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000179217    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001011541.1-355s1c1
Sequence:CCGGGAGTCCCTTACTGATGATCATCTCGAGATGATCATCAGTAAGGGACTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001011541
FLJ25758 MISSION shRNA shRNA Plasmid DNA
Human
4 Products Total
TRC Number Vector Price Set Price (4)? Select
TRCN0000181153    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001011541.1-365s1c1
Sequence:CCGGCTGATGATCATAGGCTCCTCACTCGAGTGAGGAGCCTATGATCATCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000180575    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001011541.1-352s1c1
Sequence:CCGGGAGGAGTCCCTTACTGATGATCTCGAGATCATCAGTAAGGGACTCCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000179580    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001011541.1-588s1c1
Sequence:CCGGGCTGTTCCTAGTCATGGATTACTCGAGTAATCCATGACTAGGAACAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000179217    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001011541.1-355s1c1
Sequence:CCGGGAGTCCCTTACTGATGATCATCTCGAGATGATCATCAGTAAGGGACTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001011541
FLJ25758 MISSION shRNA Lentiviral Transduction Particles
Human
4 Products Total
TRC Number Volume Titer Vector Price Set Price (4)? Select
TRCN0000181153    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001011541.1-365s1c1
Sequence:CCGGCTGATGATCATAGGCTCCTCACTCGAGTGAGGAGCCTATGATCATCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000180575    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001011541.1-352s1c1
Sequence:CCGGGAGGAGTCCCTTACTGATGATCTCGAGATCATCAGTAAGGGACTCCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000179580    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001011541.1-588s1c1
Sequence:CCGGGCTGTTCCTAGTCATGGATTACTCGAGTAATCCATGACTAGGAACAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000179217    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001011541.1-355s1c1
Sequence:CCGGGAGTCCCTTACTGATGATCATCTCGAGATGATCATCAGTAAGGGACTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks