EMAIL THIS PAGE TO A FRIEND

FLJ26850

Species: Human FLJ26850(400710)
Gene ID:
42 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-XM_378812 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-XM_378812 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-XM_378812 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_001001687 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001001687 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001001687 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001001687 Rosetta Predictions human pricing
XR_040269 Rosetta Predictions human pricing
XR_040270 Rosetta Predictions human pricing
XR_040271 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001001687 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00207031 predicted 259
2 SASI_Hs01_00207032 predicted 244
3 SASI_Hs01_00207033 predicted 445
4 SASI_Hs01_00207034 predicted 393
5 SASI_Hs01_00207035 predicted 391
6 SASI_Hs01_00207036 predicted 381
7 SASI_Hs01_00207037 predicted 344
8 SASI_Hs01_00207038 predicted 430
9 SASI_Hs01_00207039 predicted 252
10 SASI_Hs01_00207040 predicted 448
siRNA
PRODUCT # siRNA Type ? SPECIES
XR_040269 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00517386 predicted 239
2 SASI_Hs02_00517387 predicted 394
3 SASI_Hs02_00517388 predicted 403
4 SASI_Hs02_00517389 predicted 574
5 SASI_Hs02_00517390 predicted 510
6 SASI_Hs02_00517391 predicted 574
7 SASI_Hs02_00517392 predicted 457
8 SASI_Hs02_00517393 predicted 377
9 SASI_Hs02_00517394 predicted 531
10 SASI_Hs02_00517395 predicted 482
siRNA
PRODUCT # siRNA Type ? SPECIES
XR_040270 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00517396 predicted 241
2 SASI_Hs02_00517397 predicted 390
3 SASI_Hs02_00517398 predicted 398
4 SASI_Hs02_00517399 predicted 575
5 SASI_Hs02_00517400 predicted 509
6 SASI_Hs02_00517401 predicted 576
7 SASI_Hs02_00517402 predicted 456
8 SASI_Hs02_00517403 predicted 383
9 SASI_Hs02_00517404 predicted 533
10 SASI_Hs02_00517405 predicted 481
siRNA
PRODUCT # siRNA Type ? SPECIES
XR_040271 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00517406 predicted 238
2 SASI_Hs02_00517407 predicted 395
3 SASI_Hs02_00517408 predicted 399
4 SASI_Hs02_00517409 predicted 572
5 SASI_Hs02_00517410 predicted 510
6 SASI_Hs02_00517411 predicted 572
7 SASI_Hs02_00517412 predicted 459
8 SASI_Hs02_00517413 predicted 383
9 SASI_Hs02_00517414 predicted 536
10 SASI_Hs02_00517415 predicted 480
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-XM_378812
FLJ26850 MISSION shRNA Bacterial Glycerol Stock
Human
1 Products Total
TRC Number Price Set Price (1)? Select
TRCN0000122650    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_378812.1-442s1c1
Sequence:CCGGGCGTCTATTTCCTGTGGATCACTCGAGTGATCCACAGGAAATAGACGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-XM_378812
FLJ26850 MISSION shRNA shRNA Plasmid DNA
Human
1 Products Total
TRC Number Vector Price Set Price (1)? Select
TRCN0000122650    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_378812.1-442s1c1
Sequence:CCGGGCGTCTATTTCCTGTGGATCACTCGAGTGATCCACAGGAAATAGACGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-XM_378812
FLJ26850 MISSION shRNA Lentiviral Transduction Particles
Human
1 Products Total
TRC Number Volume Titer Vector Price Set Price (1)? Select
TRCN0000122650    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_378812.1-442s1c1
Sequence:CCGGGCGTCTATTTCCTGTGGATCACTCGAGTGATCCACAGGAAATAGACGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001001687
FLJ26850 MISSION shRNA Bacterial Glycerol Stock
Human
6 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000140652    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001001687.1-381s1c1
Sequence:CCGGCACGAAGTCGTGGCTTATTCTCTCGAGAGAATAAGCCACGACTTCGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000139917    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001001687.1-258s1c1
Sequence:CCGGGTCAGACTCCCTGATGAACTACTCGAGTAGTTCATCAGGGAGTCTGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000139460    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001001687.1-379s1c1
Sequence:CCGGCACACGAAGTCGTGGCTTATTCTCGAGAATAAGCCACGACTTCGTGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000145044    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001001687.1-1194s1c1
Sequence:CCGGCCTAATGATTGGACGTACAAACTCGAGTTTGTACGTCCAATCATTAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000144577    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001001687.1-444s1c1
Sequence:CCGGGTCTATTTCCTGTGGATCAATCTCGAGATTGATCCACAGGAAATAGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000144784    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001001687.1-1223s1c1
Sequence:CCGGGCCAAGACTTATTTGTTGTGTCTCGAGACACAACAAATAAGTCTTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001001687
FLJ26850 MISSION shRNA shRNA Plasmid DNA
Human
6 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000140652    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001001687.1-381s1c1
Sequence:CCGGCACGAAGTCGTGGCTTATTCTCTCGAGAGAATAAGCCACGACTTCGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000139917    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001001687.1-258s1c1
Sequence:CCGGGTCAGACTCCCTGATGAACTACTCGAGTAGTTCATCAGGGAGTCTGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000139460    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001001687.1-379s1c1
Sequence:CCGGCACACGAAGTCGTGGCTTATTCTCGAGAATAAGCCACGACTTCGTGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000145044    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001001687.1-1194s1c1
Sequence:CCGGCCTAATGATTGGACGTACAAACTCGAGTTTGTACGTCCAATCATTAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000144577    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001001687.1-444s1c1
Sequence:CCGGGTCTATTTCCTGTGGATCAATCTCGAGATTGATCCACAGGAAATAGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000144784    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001001687.1-1223s1c1
Sequence:CCGGGCCAAGACTTATTTGTTGTGTCTCGAGACACAACAAATAAGTCTTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001001687
FLJ26850 MISSION shRNA Lentiviral Transduction Particles
Human
6 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000140652    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001001687.1-381s1c1
Sequence:CCGGCACGAAGTCGTGGCTTATTCTCTCGAGAGAATAAGCCACGACTTCGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000139917    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001001687.1-258s1c1
Sequence:CCGGGTCAGACTCCCTGATGAACTACTCGAGTAGTTCATCAGGGAGTCTGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000139460    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001001687.1-379s1c1
Sequence:CCGGCACACGAAGTCGTGGCTTATTCTCGAGAATAAGCCACGACTTCGTGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000145044    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001001687.1-1194s1c1
Sequence:CCGGCCTAATGATTGGACGTACAAACTCGAGTTTGTACGTCCAATCATTAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000144577    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001001687.1-444s1c1
Sequence:CCGGGTCTATTTCCTGTGGATCAATCTCGAGATTGATCCACAGGAAATAGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000144784    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001001687.1-1223s1c1
Sequence:CCGGGCCAAGACTTATTTGTTGTGTCTCGAGACACAACAAATAAGTCTTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks