EMAIL THIS PAGE TO A FRIEND

FLJ27255

10 Gene Product Result for
Species: Human FLJ27255(401281)
Gene ID:
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_207501 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_207501 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_207501 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_207501 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_207501 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00199320 predicted 635
2 SASI_Hs01_00199321 predicted 650
3 SASI_Hs01_00199322 predicted 352
4 SASI_Hs01_00199323 predicted 130
5 SASI_Hs01_00199324 predicted 511
6 SASI_Hs01_00199325 predicted 492
7 SASI_Hs01_00199326 predicted 188
8 SASI_Hs01_00199327 predicted 214
9 SASI_Hs01_00199328 predicted 470
10 SASI_Hs01_00199329 predicted 648
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_207501
FLJ27255 MISSION shRNA Bacterial Glycerol Stock
Human
3 Products Total
TRC Number Price Set Price (3)? Select
TRCN0000172724    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_207501.1-393s1c1
Sequence:CCGGGCAATATACCTGGAGGTCCATCTCGAGATGGACCTCCAGGTATATTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000172700    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_207501.1-338s1c1
Sequence:CCGGGCTCGGACTACTGCTACATTTCTCGAGAAATGTAGCAGTAGTCCGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000172474    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_207501.1-956s1c1
Sequence:CCGGCCTGAGTGACTTCATGGAGTACTCGAGTACTCCATGAAGTCACTCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_207501
FLJ27255 MISSION shRNA shRNA Plasmid DNA
Human
3 Products Total
TRC Number Vector Price Set Price (3)? Select
TRCN0000172724    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_207501.1-393s1c1
Sequence:CCGGGCAATATACCTGGAGGTCCATCTCGAGATGGACCTCCAGGTATATTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000172700    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_207501.1-338s1c1
Sequence:CCGGGCTCGGACTACTGCTACATTTCTCGAGAAATGTAGCAGTAGTCCGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000172474    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_207501.1-956s1c1
Sequence:CCGGCCTGAGTGACTTCATGGAGTACTCGAGTACTCCATGAAGTCACTCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_207501
FLJ27255 MISSION shRNA Lentiviral Transduction Particles
Human
3 Products Total
TRC Number Volume Titer Vector Price Set Price (3)? Select
TRCN0000172724    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_207501.1-393s1c1
Sequence:CCGGGCAATATACCTGGAGGTCCATCTCGAGATGGACCTCCAGGTATATTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000172700    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_207501.1-338s1c1
Sequence:CCGGGCTCGGACTACTGCTACATTTCTCGAGAAATGTAGCAGTAGTCCGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000172474    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_207501.1-956s1c1
Sequence:CCGGCCTGAGTGACTTCATGGAGTACTCGAGTACTCCATGAAGTCACTCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks