EMAIL THIS PAGE TO A FRIEND

FLJ32955

10 Gene Product Result for
Species: Human FLJ32955(150596)
Gene ID:
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_153041 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_153041 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_153041 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_153041 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_153041 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00242164 predicted 692
2 SASI_Hs01_00242165 predicted 825
3 SASI_Hs01_00242166 predicted 525
4 SASI_Hs01_00242167 predicted 839
5 SASI_Hs01_00242168 predicted 694
6 SASI_Hs01_00242169 predicted 762
7 SASI_Hs01_00242170 predicted 429
8 SASI_Hs01_00242171 predicted 756
9 SASI_Hs01_00242172 predicted 529
10 SASI_Hs01_00242173 predicted 702
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_153041
FLJ32955 MISSION shRNA Bacterial Glycerol Stock
Human
11 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000138601    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_153041.1-1130s1c1
Sequence:CCGGCCTGAGCCTCAACTTTCTGAACTCGAGTTCAGAAAGTTGAGGCTCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000137430    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153041.1-285s1c1
Sequence:CCGGGCATCATGTTACACCCTACAACTCGAGTTGTAGGGTGTAACATGATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000134084    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_153041.1-175s1c1
Sequence:CCGGCTGAATCTCTTGCTGATTCATCTCGAGATGAATCAGCAAGAGATTCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000162436    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_153041.1-524s1c1
Sequence:CCGGCTCTGTCTATGCAGGATTCTACTCGAGTAGAATCCTGCATAGACAGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000160480    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_153041.1-368s1c1
Sequence:CCGGCTTGCTTAACATTCCTCAGTTCTCGAGAACTGAGGAATGTTAAGCAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000160481    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_153041.1-689s1c1
Sequence:CCGGCGTTAGACCTTTCTCTCTAAACTCGAGTTTAGAGAGAAAGGTCTAACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000160198    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153041.1-459s1c1
Sequence:CCGGCACAAATTCCTCACTCATCTTCTCGAGAAGATGAGTGAGGAATTTGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000158796    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153041.1-371s1c1
Sequence:CCGGGCTTAACATTCCTCAGTTATTCTCGAGAATAACTGAGGAATGTTAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000158627    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_153041.1-616s1c1
Sequence:CCGGCCTCTGTTCTTAAGAGTTTATCTCGAGATAAACTCTTAAGAACAGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000158696    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_153041.1-186s1c1
Sequence:CCGGGCTGATTCATGCATTTCTATTCTCGAGAATAGAAATGCATGAATCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000160109    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_153041.1-404s1c1
Sequence:CCGGCAGAATAAAGTCTAGCTTCTTCTCGAGAAGAAGCTAGACTTTATTCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_153041
FLJ32955 MISSION shRNA shRNA Plasmid DNA
Human
11 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000138601    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_153041.1-1130s1c1
Sequence:CCGGCCTGAGCCTCAACTTTCTGAACTCGAGTTCAGAAAGTTGAGGCTCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000137430    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153041.1-285s1c1
Sequence:CCGGGCATCATGTTACACCCTACAACTCGAGTTGTAGGGTGTAACATGATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000134084    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_153041.1-175s1c1
Sequence:CCGGCTGAATCTCTTGCTGATTCATCTCGAGATGAATCAGCAAGAGATTCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000162436    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_153041.1-524s1c1
Sequence:CCGGCTCTGTCTATGCAGGATTCTACTCGAGTAGAATCCTGCATAGACAGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000160480    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_153041.1-368s1c1
Sequence:CCGGCTTGCTTAACATTCCTCAGTTCTCGAGAACTGAGGAATGTTAAGCAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000160481    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_153041.1-689s1c1
Sequence:CCGGCGTTAGACCTTTCTCTCTAAACTCGAGTTTAGAGAGAAAGGTCTAACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000160198    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153041.1-459s1c1
Sequence:CCGGCACAAATTCCTCACTCATCTTCTCGAGAAGATGAGTGAGGAATTTGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000158796    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153041.1-371s1c1
Sequence:CCGGGCTTAACATTCCTCAGTTATTCTCGAGAATAACTGAGGAATGTTAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000158627    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_153041.1-616s1c1
Sequence:CCGGCCTCTGTTCTTAAGAGTTTATCTCGAGATAAACTCTTAAGAACAGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000158696    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_153041.1-186s1c1
Sequence:CCGGGCTGATTCATGCATTTCTATTCTCGAGAATAGAAATGCATGAATCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000160109    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_153041.1-404s1c1
Sequence:CCGGCAGAATAAAGTCTAGCTTCTTCTCGAGAAGAAGCTAGACTTTATTCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_153041
FLJ32955 MISSION shRNA Lentiviral Transduction Particles
Human
11 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000138601    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_153041.1-1130s1c1
Sequence:CCGGCCTGAGCCTCAACTTTCTGAACTCGAGTTCAGAAAGTTGAGGCTCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000137430    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153041.1-285s1c1
Sequence:CCGGGCATCATGTTACACCCTACAACTCGAGTTGTAGGGTGTAACATGATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000134084    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_153041.1-175s1c1
Sequence:CCGGCTGAATCTCTTGCTGATTCATCTCGAGATGAATCAGCAAGAGATTCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000162436    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_153041.1-524s1c1
Sequence:CCGGCTCTGTCTATGCAGGATTCTACTCGAGTAGAATCCTGCATAGACAGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000160480    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_153041.1-368s1c1
Sequence:CCGGCTTGCTTAACATTCCTCAGTTCTCGAGAACTGAGGAATGTTAAGCAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000160481    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_153041.1-689s1c1
Sequence:CCGGCGTTAGACCTTTCTCTCTAAACTCGAGTTTAGAGAGAAAGGTCTAACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000160198    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153041.1-459s1c1
Sequence:CCGGCACAAATTCCTCACTCATCTTCTCGAGAAGATGAGTGAGGAATTTGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000158796    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153041.1-371s1c1
Sequence:CCGGGCTTAACATTCCTCAGTTATTCTCGAGAATAACTGAGGAATGTTAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000158627    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_153041.1-616s1c1
Sequence:CCGGCCTCTGTTCTTAAGAGTTTATCTCGAGATAAACTCTTAAGAACAGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000158696    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_153041.1-186s1c1
Sequence:CCGGGCTGATTCATGCATTTCTATTCTCGAGAATAGAAATGCATGAATCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000160109    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_153041.1-404s1c1
Sequence:CCGGCAGAATAAAGTCTAGCTTCTTCTCGAGAAGAAGCTAGACTTTATTCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks