EMAIL THIS PAGE TO A FRIEND

FLJ33360

49 Gene Product Result for
Species: Human FLJ33360(401172)
Gene ID:
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
SAB1301297 ANTI-FLJ33360 (N-TERM) antibody produced in rabbit IgG fraction of antiserum, buffered aqueous solution human
immunohistochemistry, western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001001702 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001001702 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001001702 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001001702 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001001702 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00133194 predicted 893
2 SASI_Hs01_00133196 predicted 907
3 SASI_Hs01_00133195 predicted 917
4 SASI_Hs02_00303892 predicted 927
5 SASI_Hs01_00133197 predicted 718
6 SASI_Hs02_00303893 predicted 295
7 SASI_Hs02_00303894 predicted 559
8 SASI_Hs01_00133199 predicted 663
9 SASI_Hs01_00133200 predicted 301
10 SASI_Hs01_00133201 predicted 824
11 SASI_Hs01_00133198 predicted 284
12 SASI_Hs01_00133202 predicted 690
13 SASI_Hs01_00133203 predicted 711
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001001702
FLJ33360 MISSION shRNA Bacterial Glycerol Stock
Human
6 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000172941    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001001702.1-309s1c1
Sequence:CCGGGCCTTGCCTTCTATCAGGTTTCTCGAGAAACCTGATAGAAGGCAAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000263365    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001001702.1-176s21c1
Sequence:CCGGCCTCCATCCAACAACGTAGATCTCGAGATCTACGTTGTTGGATGGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000263367    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001001702.1-303s21c1
Sequence:CCGGACATTGGCCTTGCCTTCTATCCTCGAGGATAGAAGGCAAGGCCAATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000263369    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001001702.1-141s21c1
Sequence:CCGGATGATCTACCTCTTTGCTTTACTCGAGTAAAGCAAAGAGGTAGATCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000263368    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001001702.1-446s21c1
Sequence:CCGGACCCGTCTTCTAGGGACATTGCTCGAGCAATGTCCCTAGAAGACGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000263366    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001001702.1-1333s21c1
Sequence:CCGGTAGTGCCCAGCCGTCGTTATTCTCGAGAATAACGACGGCTGGGCACTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001001702
FLJ33360 MISSION shRNA shRNA Plasmid DNA
Human
6 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000172941    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001001702.1-309s1c1
Sequence:CCGGGCCTTGCCTTCTATCAGGTTTCTCGAGAAACCTGATAGAAGGCAAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000263365    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001001702.1-176s21c1
Sequence:CCGGCCTCCATCCAACAACGTAGATCTCGAGATCTACGTTGTTGGATGGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000263367    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001001702.1-303s21c1
Sequence:CCGGACATTGGCCTTGCCTTCTATCCTCGAGGATAGAAGGCAAGGCCAATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000263369    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001001702.1-141s21c1
Sequence:CCGGATGATCTACCTCTTTGCTTTACTCGAGTAAAGCAAAGAGGTAGATCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000263368    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001001702.1-446s21c1
Sequence:CCGGACCCGTCTTCTAGGGACATTGCTCGAGCAATGTCCCTAGAAGACGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000263366    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001001702.1-1333s21c1
Sequence:CCGGTAGTGCCCAGCCGTCGTTATTCTCGAGAATAACGACGGCTGGGCACTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001001702
FLJ33360 MISSION shRNA Lentiviral Transduction Particles
Human
6 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000172941    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001001702.1-309s1c1
Sequence:CCGGGCCTTGCCTTCTATCAGGTTTCTCGAGAAACCTGATAGAAGGCAAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000263365    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001001702.1-176s21c1
Sequence:CCGGCCTCCATCCAACAACGTAGATCTCGAGATCTACGTTGTTGGATGGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000263367    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001001702.1-303s21c1
Sequence:CCGGACATTGGCCTTGCCTTCTATCCTCGAGGATAGAAGGCAAGGCCAATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000263369    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001001702.1-141s21c1
Sequence:CCGGATGATCTACCTCTTTGCTTTACTCGAGTAAAGCAAAGAGGTAGATCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000263368    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001001702.1-446s21c1
Sequence:CCGGACCCGTCTTCTAGGGACATTGCTCGAGCAATGTCCCTAGAAGACGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000263366    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001001702.1-1333s21c1
Sequence:CCGGTAGTGCCCAGCCGTCGTTATTCTCGAGAATAACGACGGCTGGGCACTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks