EMAIL THIS PAGE TO A FRIEND

FLJ33534

Species: Human FLJ33534(285150)
Gene ID:
16 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_182586 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_182586 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_182586 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_182586 Rosetta Predictions human pricing
XR_040331 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_182586 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00227439 predicted 1046
2 SASI_Hs01_00227440 predicted 934
3 SASI_Hs01_00227441 predicted 330
4 SASI_Hs01_00227442 predicted 922
5 SASI_Hs01_00227443 predicted 1132
6 SASI_Hs01_00227444 predicted 337
7 SASI_Hs01_00227445 predicted 642
8 SASI_Hs01_00227446 predicted 1322
9 SASI_Hs01_00227447 predicted 315
10 SASI_Hs01_00227448 predicted 998
siRNA
PRODUCT # siRNA Type ? SPECIES
XR_040331 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00517906 predicted 855
2 SASI_Hs02_00517907 predicted 867
3 SASI_Hs02_00517908 predicted 881
4 SASI_Hs02_00517909 predicted 978
5 SASI_Hs02_00517910 predicted 996
6 SASI_Hs02_00517911 predicted 997
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_182586
FLJ33534 MISSION shRNA Bacterial Glycerol Stock
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000166236    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_182586.1-632s1c1
Sequence:CCGGCAAACACGATGTGGGAAGTGTCTCGAGACACTTCCCACATCGTGTTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000164225    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_182586.1-1812s1c1
Sequence:CCGGCCCATTTGACAAGTAGGCAAACTCGAGTTTGCCTACTTGTCAAATGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000164265    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_182586.1-638s1c1
Sequence:CCGGCGATGTGGGAAGTGTGTTAAACTCGAGTTTAACACACTTCCCACATCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000165306    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_182586.1-408s1c1
Sequence:CCGGGCCGAATGCATTATGGGAGAACTCGAGTTCTCCCATAATGCATTCGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000164725    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_182586.1-988s1c1
Sequence:CCGGCGTCACTCTGTGTCATGGAAACTCGAGTTTCCATGACACAGAGTGACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000164226    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_182586.1-409s1c1
Sequence:CCGGCCGAATGCATTATGGGAGAAACTCGAGTTTCTCCCATAATGCATTCGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000161882    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_182586.1-1914s1c1
Sequence:CCGGGCTTCTGTAACAGGGATATTACTCGAGTAATATCCCTGTTACAGAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000163027    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_182586.1-430s1c1
Sequence:CCGGGCAGGTCTCGTGGATAATATTCTCGAGAATATTATCCACGAGACCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000163249    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_182586.1-772s1c1
Sequence:CCGGGATTCAGCTAAATCCTGGGAACTCGAGTTCCCAGGATTTAGCTGAATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_182586
FLJ33534 MISSION shRNA shRNA Plasmid DNA
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000166236    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_182586.1-632s1c1
Sequence:CCGGCAAACACGATGTGGGAAGTGTCTCGAGACACTTCCCACATCGTGTTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000164225    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_182586.1-1812s1c1
Sequence:CCGGCCCATTTGACAAGTAGGCAAACTCGAGTTTGCCTACTTGTCAAATGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000164265    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_182586.1-638s1c1
Sequence:CCGGCGATGTGGGAAGTGTGTTAAACTCGAGTTTAACACACTTCCCACATCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000165306    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_182586.1-408s1c1
Sequence:CCGGGCCGAATGCATTATGGGAGAACTCGAGTTCTCCCATAATGCATTCGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000164725    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_182586.1-988s1c1
Sequence:CCGGCGTCACTCTGTGTCATGGAAACTCGAGTTTCCATGACACAGAGTGACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000164226    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_182586.1-409s1c1
Sequence:CCGGCCGAATGCATTATGGGAGAAACTCGAGTTTCTCCCATAATGCATTCGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000161882    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_182586.1-1914s1c1
Sequence:CCGGGCTTCTGTAACAGGGATATTACTCGAGTAATATCCCTGTTACAGAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000163027    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_182586.1-430s1c1
Sequence:CCGGGCAGGTCTCGTGGATAATATTCTCGAGAATATTATCCACGAGACCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000163249    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_182586.1-772s1c1
Sequence:CCGGGATTCAGCTAAATCCTGGGAACTCGAGTTCCCAGGATTTAGCTGAATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_182586
FLJ33534 MISSION shRNA Lentiviral Transduction Particles
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000166236    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_182586.1-632s1c1
Sequence:CCGGCAAACACGATGTGGGAAGTGTCTCGAGACACTTCCCACATCGTGTTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000164225    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_182586.1-1812s1c1
Sequence:CCGGCCCATTTGACAAGTAGGCAAACTCGAGTTTGCCTACTTGTCAAATGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000164265    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_182586.1-638s1c1
Sequence:CCGGCGATGTGGGAAGTGTGTTAAACTCGAGTTTAACACACTTCCCACATCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000165306    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_182586.1-408s1c1
Sequence:CCGGGCCGAATGCATTATGGGAGAACTCGAGTTCTCCCATAATGCATTCGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000164725    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_182586.1-988s1c1
Sequence:CCGGCGTCACTCTGTGTCATGGAAACTCGAGTTTCCATGACACAGAGTGACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000164226    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_182586.1-409s1c1
Sequence:CCGGCCGAATGCATTATGGGAGAAACTCGAGTTTCTCCCATAATGCATTCGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000161882    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_182586.1-1914s1c1
Sequence:CCGGGCTTCTGTAACAGGGATATTACTCGAGTAATATCCCTGTTACAGAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000163027    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_182586.1-430s1c1
Sequence:CCGGGCAGGTCTCGTGGATAATATTCTCGAGAATATTATCCACGAGACCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000163249    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_182586.1-772s1c1
Sequence:CCGGGATTCAGCTAAATCCTGGGAACTCGAGTTCCCAGGATTTAGCTGAATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks