EMAIL THIS PAGE TO A FRIEND

FLJ35816

12 Gene Product Result for
Species: Human FLJ35816(401114)
Gene ID:
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_207489 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_207489 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_207489 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001039067 Rosetta Predictions human pricing
XR_039811 Rosetta Predictions human pricing
XR_039812 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001039067 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00169001 predicted 1150
2 SASI_Hs01_00169002 predicted 1016
siRNA
PRODUCT # siRNA Type ? SPECIES
XR_039811 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00513332 predicted 336
2 SASI_Hs02_00513333 predicted 341
3 SASI_Hs02_00513334 predicted 331
4 SASI_Hs02_00513335 predicted 337
5 SASI_Hs02_00513336 predicted 380
siRNA
PRODUCT # siRNA Type ? SPECIES
XR_039812 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00513337 predicted 339
2 SASI_Hs02_00513338 predicted 347
3 SASI_Hs02_00513339 predicted 333
4 SASI_Hs02_00513340 predicted 331
5 SASI_Hs02_00513341 predicted 378
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_207489
FLJ35816 MISSION shRNA Bacterial Glycerol Stock
Human
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000164454    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_207489.1-1967s1c1
Sequence:CCGGCAGCATTATGTTCACTGCCAACTCGAGTTGGCAGTGAACATAATGCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000163593    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_207489.1-1069s1c1
Sequence:CCGGGAGTCCCAAATATGGCTTCATCTCGAGATGAAGCCATATTTGGGACTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000159183    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_207489.1-1921s1c1
Sequence:CCGGGCTGTTAGGTTTGAATAACTTCTCGAGAAGTTATTCAAACCTAACAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000158632    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_207489.1-1272s1c1
Sequence:CCGGCAAAGGTAATGACCAAGATAACTCGAGTTATCTTGGTCATTACCTTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000159238    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_207489.1-1318s1c1
Sequence:CCGGCATTGTAAGATTGAATGGGATCTCGAGATCCCATTCAATCTTACAATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000162378    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_207489.1-1782s1c1
Sequence:CCGGCAACCACTATTAGAGTGAGAACTCGAGTTCTCACTCTAATAGTGGTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000163324    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_207489.1-1983s1c1
Sequence:CCGGGCCAAGTAATATGGACGTAGACTCGAGTCTACGTCCATATTACTTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_207489
FLJ35816 MISSION shRNA shRNA Plasmid DNA
Human
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000164454    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_207489.1-1967s1c1
Sequence:CCGGCAGCATTATGTTCACTGCCAACTCGAGTTGGCAGTGAACATAATGCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000163593    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_207489.1-1069s1c1
Sequence:CCGGGAGTCCCAAATATGGCTTCATCTCGAGATGAAGCCATATTTGGGACTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000159183    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_207489.1-1921s1c1
Sequence:CCGGGCTGTTAGGTTTGAATAACTTCTCGAGAAGTTATTCAAACCTAACAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000158632    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_207489.1-1272s1c1
Sequence:CCGGCAAAGGTAATGACCAAGATAACTCGAGTTATCTTGGTCATTACCTTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000159238    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_207489.1-1318s1c1
Sequence:CCGGCATTGTAAGATTGAATGGGATCTCGAGATCCCATTCAATCTTACAATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000162378    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_207489.1-1782s1c1
Sequence:CCGGCAACCACTATTAGAGTGAGAACTCGAGTTCTCACTCTAATAGTGGTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000163324    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_207489.1-1983s1c1
Sequence:CCGGGCCAAGTAATATGGACGTAGACTCGAGTCTACGTCCATATTACTTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_207489
FLJ35816 MISSION shRNA Lentiviral Transduction Particles
Human
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000164454    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_207489.1-1967s1c1
Sequence:CCGGCAGCATTATGTTCACTGCCAACTCGAGTTGGCAGTGAACATAATGCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000163593    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_207489.1-1069s1c1
Sequence:CCGGGAGTCCCAAATATGGCTTCATCTCGAGATGAAGCCATATTTGGGACTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000159183    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_207489.1-1921s1c1
Sequence:CCGGGCTGTTAGGTTTGAATAACTTCTCGAGAAGTTATTCAAACCTAACAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000158632    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_207489.1-1272s1c1
Sequence:CCGGCAAAGGTAATGACCAAGATAACTCGAGTTATCTTGGTCATTACCTTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000159238    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_207489.1-1318s1c1
Sequence:CCGGCATTGTAAGATTGAATGGGATCTCGAGATCCCATTCAATCTTACAATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000162378    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_207489.1-1782s1c1
Sequence:CCGGCAACCACTATTAGAGTGAGAACTCGAGTTCTCACTCTAATAGTGGTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000163324    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_207489.1-1983s1c1
Sequence:CCGGGCCAAGTAATATGGACGTAGACTCGAGTCTACGTCCATATTACTTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks