EMAIL THIS PAGE TO A FRIEND

FLJ35934

20 Gene Product Result for
Species: Human FLJ35934(400579)
Gene ID:
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_207453 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_207453 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_207453 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_207453 Rosetta Predictions human pricing
XR_041166 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_207453 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00225715 predicted 748
2 SASI_Hs01_00225716 predicted 736
3 SASI_Hs01_00225717 predicted 798
4 SASI_Hs01_00225718 predicted 845
5 SASI_Hs01_00225719 predicted 729
6 SASI_Hs01_00225720 predicted 798
7 SASI_Hs01_00225721 predicted 802
8 SASI_Hs01_00225722 predicted 741
9 SASI_Hs01_00225723 predicted 1007
10 SASI_Hs01_00225724 predicted 804
siRNA
PRODUCT # siRNA Type ? SPECIES
XR_041166 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00525208 predicted 337
2 SASI_Hs02_00525209 predicted 352
3 SASI_Hs02_00525210 predicted 392
4 SASI_Hs02_00525211 predicted 660
5 SASI_Hs02_00525212 predicted 318
6 SASI_Hs02_00525213 predicted 416
7 SASI_Hs02_00525214 predicted 391
8 SASI_Hs02_00525215 predicted 347
9 SASI_Hs02_00525216 predicted 430
10 SASI_Hs02_00525217 predicted 1211
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_207453
FLJ35934 MISSION shRNA Bacterial Glycerol Stock
Human
6 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000166429    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_207453.1-800s1c1
Sequence:CCGGCCTCTTATTCTCCGCCATCTTCTCGAGAAGATGGCGGAGAATAAGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000165744    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_207453.1-955s1c1
Sequence:CCGGCAACTGCCTTTCACCTAGAAGCTCGAGCTTCTAGGTGAAAGGCAGTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000162963    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_207453.1-747s1c1
Sequence:CCGGGCAATCTTCTTCCCACTTTCTCTCGAGAGAAAGTGGGAAGAAGATTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000162689    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_207453.1-748s1c1
Sequence:CCGGCAATCTTCTTCCCACTTTCTTCTCGAGAAGAAAGTGGGAAGAAGATTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000165662    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_207453.1-1596s1c1
Sequence:CCGGGTGAGCTGAGAACTCACCATTCTCGAGAATGGTGAGTTCTCAGCTCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000164789    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_207453.1-1470s1c1
Sequence:CCGGCATGCTGAAACCCAGTCTCTACTCGAGTAGAGACTGGGTTTCAGCATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_207453
FLJ35934 MISSION shRNA shRNA Plasmid DNA
Human
6 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000166429    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_207453.1-800s1c1
Sequence:CCGGCCTCTTATTCTCCGCCATCTTCTCGAGAAGATGGCGGAGAATAAGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000165744    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_207453.1-955s1c1
Sequence:CCGGCAACTGCCTTTCACCTAGAAGCTCGAGCTTCTAGGTGAAAGGCAGTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000162963    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_207453.1-747s1c1
Sequence:CCGGGCAATCTTCTTCCCACTTTCTCTCGAGAGAAAGTGGGAAGAAGATTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000162689    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_207453.1-748s1c1
Sequence:CCGGCAATCTTCTTCCCACTTTCTTCTCGAGAAGAAAGTGGGAAGAAGATTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000165662    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_207453.1-1596s1c1
Sequence:CCGGGTGAGCTGAGAACTCACCATTCTCGAGAATGGTGAGTTCTCAGCTCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000164789    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_207453.1-1470s1c1
Sequence:CCGGCATGCTGAAACCCAGTCTCTACTCGAGTAGAGACTGGGTTTCAGCATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_207453
FLJ35934 MISSION shRNA Lentiviral Transduction Particles
Human
6 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000166429    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_207453.1-800s1c1
Sequence:CCGGCCTCTTATTCTCCGCCATCTTCTCGAGAAGATGGCGGAGAATAAGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000165744    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_207453.1-955s1c1
Sequence:CCGGCAACTGCCTTTCACCTAGAAGCTCGAGCTTCTAGGTGAAAGGCAGTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000162963    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_207453.1-747s1c1
Sequence:CCGGGCAATCTTCTTCCCACTTTCTCTCGAGAGAAAGTGGGAAGAAGATTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000162689    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_207453.1-748s1c1
Sequence:CCGGCAATCTTCTTCCCACTTTCTTCTCGAGAAGAAAGTGGGAAGAAGATTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000165662    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_207453.1-1596s1c1
Sequence:CCGGGTGAGCTGAGAACTCACCATTCTCGAGAATGGTGAGTTCTCAGCTCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000164789    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_207453.1-1470s1c1
Sequence:CCGGCATGCTGAAACCCAGTCTCTACTCGAGTAGAGACTGGGTTTCAGCATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks