EMAIL THIS PAGE TO A FRIEND

FLJ37035

2 Gene Product Result for
Species: Human FLJ37035(399821)
Gene ID:
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_207425 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_207425 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_207425 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_207425
FLJ37035 MISSION shRNA Bacterial Glycerol Stock
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000166177    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_207425.1-439s1c1
Sequence:CCGGCCTGGAGAGCTTTGAGATTCTCTCGAGAGAATCTCAAAGCTCTCCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000161600    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_207425.1-447s1c1
Sequence:CCGGGCTTTGAGATTCTGGTACAAACTCGAGTTTGTACCAGAATCTCAAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000159906    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_207425.1-659s1c1
Sequence:CCGGGTCATTTAGAATGCAACTCTTCTCGAGAAGAGTTGCATTCTAAATGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000160399    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_207425.1-587s1c1
Sequence:CCGGCATTACAGATATCCTTGTGATCTCGAGATCACAAGGATATCTGTAATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000163383    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_207425.1-737s1c1
Sequence:CCGGGAAATGTCCACTAACATGGCTCTCGAGAGCCATGTTAGTGGACATTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000163299    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_207425.1-730s1c1
Sequence:CCGGGAGTGGAGAAATGTCCACTAACTCGAGTTAGTGGACATTTCTCCACTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000163323    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_207425.1-537s1c1
Sequence:CCGGGAATCTTCCTCTTGTCTGTCACTCGAGTGACAGACAAGAGGAAGATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000164534    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_207425.1-592s1c1
Sequence:CCGGCAGATATCCTTGTGATGGTCTCTCGAGAGACCATCACAAGGATATCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_207425
FLJ37035 MISSION shRNA shRNA Plasmid DNA
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000166177    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_207425.1-439s1c1
Sequence:CCGGCCTGGAGAGCTTTGAGATTCTCTCGAGAGAATCTCAAAGCTCTCCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000161600    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_207425.1-447s1c1
Sequence:CCGGGCTTTGAGATTCTGGTACAAACTCGAGTTTGTACCAGAATCTCAAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000159906    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_207425.1-659s1c1
Sequence:CCGGGTCATTTAGAATGCAACTCTTCTCGAGAAGAGTTGCATTCTAAATGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000160399    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_207425.1-587s1c1
Sequence:CCGGCATTACAGATATCCTTGTGATCTCGAGATCACAAGGATATCTGTAATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000163383    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_207425.1-737s1c1
Sequence:CCGGGAAATGTCCACTAACATGGCTCTCGAGAGCCATGTTAGTGGACATTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000163299    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_207425.1-730s1c1
Sequence:CCGGGAGTGGAGAAATGTCCACTAACTCGAGTTAGTGGACATTTCTCCACTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000163323    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_207425.1-537s1c1
Sequence:CCGGGAATCTTCCTCTTGTCTGTCACTCGAGTGACAGACAAGAGGAAGATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000164534    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_207425.1-592s1c1
Sequence:CCGGCAGATATCCTTGTGATGGTCTCTCGAGAGACCATCACAAGGATATCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_207425
FLJ37035 MISSION shRNA Lentiviral Transduction Particles
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000166177    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_207425.1-439s1c1
Sequence:CCGGCCTGGAGAGCTTTGAGATTCTCTCGAGAGAATCTCAAAGCTCTCCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000161600    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_207425.1-447s1c1
Sequence:CCGGGCTTTGAGATTCTGGTACAAACTCGAGTTTGTACCAGAATCTCAAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000159906    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_207425.1-659s1c1
Sequence:CCGGGTCATTTAGAATGCAACTCTTCTCGAGAAGAGTTGCATTCTAAATGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000160399    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_207425.1-587s1c1
Sequence:CCGGCATTACAGATATCCTTGTGATCTCGAGATCACAAGGATATCTGTAATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000163383    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_207425.1-737s1c1
Sequence:CCGGGAAATGTCCACTAACATGGCTCTCGAGAGCCATGTTAGTGGACATTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000163299    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_207425.1-730s1c1
Sequence:CCGGGAGTGGAGAAATGTCCACTAACTCGAGTTAGTGGACATTTCTCCACTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000163323    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_207425.1-537s1c1
Sequence:CCGGGAATCTTCCTCTTGTCTGTCACTCGAGTGACAGACAAGAGGAAGATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000164534    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_207425.1-592s1c1
Sequence:CCGGCAGATATCCTTGTGATGGTCTCTCGAGAGACCATCACAAGGATATCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks