EMAIL THIS PAGE TO A FRIEND

FLJ38717

40 Gene Product Result for
Species: Human FLJ38717(401261)
Gene ID:
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001004322 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001004322 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001004322 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001004322 Rosetta Predictions human pricing
XR_040734 Rosetta Predictions human pricing
XR_040735 Rosetta Predictions human pricing
XR_040736 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001004322 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00083870 predicted 405
2 SASI_Hs01_00083871 predicted 428
3 SASI_Hs01_00083872 predicted 406
4 SASI_Hs01_00083873 predicted 659
5 SASI_Hs01_00083874 predicted 591
6 SASI_Hs01_00083875 predicted 605
7 SASI_Hs01_00083876 predicted 342
8 SASI_Hs01_00083877 predicted 433
9 SASI_Hs01_00083878 predicted 564
10 SASI_Hs01_00083879 predicted 497
siRNA
PRODUCT # siRNA Type ? SPECIES
XR_040734 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00521441 predicted 1402
2 SASI_Hs02_00521442 predicted 512
3 SASI_Hs02_00521443 predicted 539
4 SASI_Hs02_00521444 predicted 1452
5 SASI_Hs02_00521445 predicted 1363
6 SASI_Hs02_00521446 predicted 455
7 SASI_Hs02_00521447 predicted 544
8 SASI_Hs02_00521448 predicted 460
9 SASI_Hs02_00521449 predicted 608
10 SASI_Hs02_00521450 predicted 536
siRNA
PRODUCT # siRNA Type ? SPECIES
XR_040735 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00521451 predicted 645
2 SASI_Hs02_00521452 predicted 812
3 SASI_Hs02_00521453 predicted 819
4 SASI_Hs02_00521454 predicted 1002
5 SASI_Hs02_00521455 predicted 560
6 SASI_Hs02_00521456 predicted 1004
7 SASI_Hs02_00521457 predicted 785
8 SASI_Hs02_00521458 predicted 564
9 SASI_Hs02_00521459 predicted 713
10 SASI_Hs02_00521460 predicted 906
siRNA
PRODUCT # siRNA Type ? SPECIES
XR_040736 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00521461 predicted 643
2 SASI_Hs02_00521462 predicted 811
3 SASI_Hs02_00521463 predicted 816
4 SASI_Hs02_00521464 predicted 1002
5 SASI_Hs02_00521465 predicted 553
6 SASI_Hs02_00521466 predicted 999
7 SASI_Hs02_00521467 predicted 778
8 SASI_Hs02_00521468 predicted 557
9 SASI_Hs02_00521469 predicted 716
10 SASI_Hs02_00521470 predicted 912
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001004322
FLJ38717 MISSION shRNA Bacterial Glycerol Stock
Human
4 Products Total
TRC Number Price Set Price (4)? Select
TRCN0000168203    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001004322.1-1945s1c1
Sequence:CCGGCCCGCTATATCCAAAGATCTACTCGAGTAGATCTTTGGATATAGCGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000167149    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001004322.1-1442s1c1
Sequence:CCGGCCACATACATGGAAAGTAAATCTCGAGATTTACTTTCCATGTATGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000167198    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001004322.1-1328s1c1
Sequence:CCGGCCATGTAAGTATCTGTTGGTACTCGAGTACCAACAGATACTTACATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000167783    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001004322.1-1547s1c1
Sequence:CCGGGACCATTTAATGAGACCTATTCTCGAGAATAGGTCTCATTAAATGGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001004322
FLJ38717 MISSION shRNA shRNA Plasmid DNA
Human
4 Products Total
TRC Number Vector Price Set Price (4)? Select
TRCN0000168203    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001004322.1-1945s1c1
Sequence:CCGGCCCGCTATATCCAAAGATCTACTCGAGTAGATCTTTGGATATAGCGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000167149    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001004322.1-1442s1c1
Sequence:CCGGCCACATACATGGAAAGTAAATCTCGAGATTTACTTTCCATGTATGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000167198    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001004322.1-1328s1c1
Sequence:CCGGCCATGTAAGTATCTGTTGGTACTCGAGTACCAACAGATACTTACATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000167783    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001004322.1-1547s1c1
Sequence:CCGGGACCATTTAATGAGACCTATTCTCGAGAATAGGTCTCATTAAATGGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001004322
FLJ38717 MISSION shRNA Lentiviral Transduction Particles
Human
4 Products Total
TRC Number Volume Titer Vector Price Set Price (4)? Select
TRCN0000168203    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001004322.1-1945s1c1
Sequence:CCGGCCCGCTATATCCAAAGATCTACTCGAGTAGATCTTTGGATATAGCGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000167149    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001004322.1-1442s1c1
Sequence:CCGGCCACATACATGGAAAGTAAATCTCGAGATTTACTTTCCATGTATGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000167198    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001004322.1-1328s1c1
Sequence:CCGGCCATGTAAGTATCTGTTGGTACTCGAGTACCAACAGATACTTACATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000167783    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001004322.1-1547s1c1
Sequence:CCGGGACCATTTAATGAGACCTATTCTCGAGAATAGGTCTCATTAAATGGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks