EMAIL THIS PAGE TO A FRIEND

FLJ38723

27 Gene Product Result for
Species: Human FLJ38723(255180)
Gene ID:
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_173805 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_173805 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_173805 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_173805 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_173805 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00049299 predicted 280
2 SASI_Hs01_00049300 predicted 876
3 SASI_Hs01_00049301 predicted 555
4 SASI_Hs01_00049302 predicted 222
5 SASI_Hs01_00049303 predicted 777
6 SASI_Hs01_00049304 predicted 854
7 SASI_Hs01_00049305 predicted 156
8 SASI_Hs01_00049306 predicted 71
9 SASI_Hs01_00049307 predicted 176
10 SASI_Hs01_00049308 predicted 175
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_173805
FLJ38723 MISSION shRNA Bacterial Glycerol Stock
Human
12 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000156221    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_173805.2-2247s1c1
Sequence:CCGGCGAGAGGAAAGTACGTCACATCTCGAGATGTGACGTACTTTCCTCTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000155115    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_173805.2-219s1c1
Sequence:CCGGGAGTATCTGCATGGAGAGAGTCTCGAGACTCTCTCCATGCAGATACTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000154758    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173805.2-47s1c1
Sequence:CCGGGAAGCAGGAGAACTCAGCTTTCTCGAGAAAGCTGAGTTCTCCTGCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000154213    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_173805.2-1525s1c1
Sequence:CCGGCCATGCCTTCTCATTCTCTTTCTCGAGAAAGAGAATGAGAAGGCATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000153673    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_173805.2-1813s1c1
Sequence:CCGGCCATTTCACCTGAGACCAATACTCGAGTATTGGTCTCAGGTGAAATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000150390    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_173805.2-75s1c1
Sequence:CCGGCAGCTTCAAGTTGTACTGATTCTCGAGAATCAGTACAACTTGAAGCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000152706    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_173805.2-84s1c1
Sequence:CCGGGTTGTACTGATTGACAAGGCACTCGAGTGCCTTGTCAATCAGTACAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000152735    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_173805.2-195s1c1
Sequence:CCGGCAAATGGAGAGAGAGCAGTATCTCGAGATACTGCTCTCTCTCCATTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000153194    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173805.2-74s1c1
Sequence:CCGGGCAGCTTCAAGTTGTACTGATCTCGAGATCAGTACAACTTGAAGCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000153368    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_173805.2-182s1c1
Sequence:CCGGGCTGAAGTATCTGCAAATGGACTCGAGTCCATTTGCAGATACTTCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000154786    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_173805.2-401s1c1
Sequence:CCGGGAAGTGGAGCAGAAGCTACAACTCGAGTTGTAGCTTCTGCTCCACTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000154542    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_173805.2-333s1c1
Sequence:CCGGGAGACGATCTTGGCTGAACTACTCGAGTAGTTCAGCCAAGATCGTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_173805
FLJ38723 MISSION shRNA shRNA Plasmid DNA
Human
12 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000156221    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_173805.2-2247s1c1
Sequence:CCGGCGAGAGGAAAGTACGTCACATCTCGAGATGTGACGTACTTTCCTCTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000155115    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_173805.2-219s1c1
Sequence:CCGGGAGTATCTGCATGGAGAGAGTCTCGAGACTCTCTCCATGCAGATACTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000154758    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173805.2-47s1c1
Sequence:CCGGGAAGCAGGAGAACTCAGCTTTCTCGAGAAAGCTGAGTTCTCCTGCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000154213    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_173805.2-1525s1c1
Sequence:CCGGCCATGCCTTCTCATTCTCTTTCTCGAGAAAGAGAATGAGAAGGCATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000153673    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_173805.2-1813s1c1
Sequence:CCGGCCATTTCACCTGAGACCAATACTCGAGTATTGGTCTCAGGTGAAATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000150390    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_173805.2-75s1c1
Sequence:CCGGCAGCTTCAAGTTGTACTGATTCTCGAGAATCAGTACAACTTGAAGCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000152706    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_173805.2-84s1c1
Sequence:CCGGGTTGTACTGATTGACAAGGCACTCGAGTGCCTTGTCAATCAGTACAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000152735    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_173805.2-195s1c1
Sequence:CCGGCAAATGGAGAGAGAGCAGTATCTCGAGATACTGCTCTCTCTCCATTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000153194    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173805.2-74s1c1
Sequence:CCGGGCAGCTTCAAGTTGTACTGATCTCGAGATCAGTACAACTTGAAGCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000153368    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_173805.2-182s1c1
Sequence:CCGGGCTGAAGTATCTGCAAATGGACTCGAGTCCATTTGCAGATACTTCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000154786    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_173805.2-401s1c1
Sequence:CCGGGAAGTGGAGCAGAAGCTACAACTCGAGTTGTAGCTTCTGCTCCACTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000154542    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_173805.2-333s1c1
Sequence:CCGGGAGACGATCTTGGCTGAACTACTCGAGTAGTTCAGCCAAGATCGTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_173805
FLJ38723 MISSION shRNA Lentiviral Transduction Particles
Human
12 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000156221    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_173805.2-2247s1c1
Sequence:CCGGCGAGAGGAAAGTACGTCACATCTCGAGATGTGACGTACTTTCCTCTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000155115    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_173805.2-219s1c1
Sequence:CCGGGAGTATCTGCATGGAGAGAGTCTCGAGACTCTCTCCATGCAGATACTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000154758    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173805.2-47s1c1
Sequence:CCGGGAAGCAGGAGAACTCAGCTTTCTCGAGAAAGCTGAGTTCTCCTGCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000154213    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_173805.2-1525s1c1
Sequence:CCGGCCATGCCTTCTCATTCTCTTTCTCGAGAAAGAGAATGAGAAGGCATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000153673    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_173805.2-1813s1c1
Sequence:CCGGCCATTTCACCTGAGACCAATACTCGAGTATTGGTCTCAGGTGAAATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000150390    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_173805.2-75s1c1
Sequence:CCGGCAGCTTCAAGTTGTACTGATTCTCGAGAATCAGTACAACTTGAAGCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000152706    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_173805.2-84s1c1
Sequence:CCGGGTTGTACTGATTGACAAGGCACTCGAGTGCCTTGTCAATCAGTACAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000152735    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_173805.2-195s1c1
Sequence:CCGGCAAATGGAGAGAGAGCAGTATCTCGAGATACTGCTCTCTCTCCATTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000153194    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173805.2-74s1c1
Sequence:CCGGGCAGCTTCAAGTTGTACTGATCTCGAGATCAGTACAACTTGAAGCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000153368    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_173805.2-182s1c1
Sequence:CCGGGCTGAAGTATCTGCAAATGGACTCGAGTCCATTTGCAGATACTTCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000154786    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_173805.2-401s1c1
Sequence:CCGGGAAGTGGAGCAGAAGCTACAACTCGAGTTGTAGCTTCTGCTCCACTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000154542    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_173805.2-333s1c1
Sequence:CCGGGAGACGATCTTGGCTGAACTACTCGAGTAGTTCAGCCAAGATCGTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks