EMAIL THIS PAGE TO A FRIEND

FLJ39739

32 Gene Product Result for
Species: Human FLJ39739(388685)
Gene ID:
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_207400 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_207400 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_207400 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-XM_371301 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-XM_371301 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-XM_371301 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_207400 Rosetta Predictions human pricing
XR_039904 Rosetta Predictions human pricing
XR_039905 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_207400 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00183140 predicted 244
2 SASI_Hs01_00183141 predicted 235
3 SASI_Hs01_00183142 predicted 490
4 SASI_Hs01_00183143 predicted 241
5 SASI_Hs01_00183144 predicted 392
6 SASI_Hs01_00183145 predicted 237
7 SASI_Hs01_00183146 predicted 487
8 SASI_Hs01_00183147 predicted 484
9 SASI_Hs01_00183148 predicted 239
10 SASI_Hs01_00183149 predicted 477
siRNA
PRODUCT # siRNA Type ? SPECIES
XR_039904 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00514103 predicted 675
2 SASI_Hs02_00514104 predicted 670
3 SASI_Hs02_00514105 predicted 681
4 SASI_Hs02_00514106 predicted 129
5 SASI_Hs02_00514107 predicted 700
6 SASI_Hs02_00514108 predicted 710
7 SASI_Hs02_00514109 predicted 71
8 SASI_Hs02_00514110 predicted 15
9 SASI_Hs02_00514111 predicted 704
10 SASI_Hs02_00514112 predicted 727
siRNA
PRODUCT # siRNA Type ? SPECIES
XR_039905 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00514113 predicted 209
2 SASI_Hs02_00514114 predicted 206
3 SASI_Hs02_00514115 predicted 206
4 SASI_Hs02_00514116 predicted 214
5 SASI_Hs02_00514117 predicted 272
6 SASI_Hs02_00514118 predicted 203
7 SASI_Hs02_00514119 predicted 263
8 SASI_Hs02_00514120 predicted 207
9 SASI_Hs02_00514121 predicted 252
10 SASI_Hs02_00514122 predicted 203
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_207400
FLJ39739 MISSION shRNA Bacterial Glycerol Stock
Human
4 Products Total
TRC Number Price Set Price (4)? Select
TRCN0000144873    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_207400.1-640s1c1
Sequence:CCGGGATTCACCACTCTAATCTCTTCTCGAGAAGAGATTAGAGTGGTGAATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000140788    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_207400.1-233s1c1
Sequence:CCGGGCTAAAGGCGAGGATGGATTACTCGAGTAATCCATCCTCGCCTTTAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000139485    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_207400.1-674s1c1
Sequence:CCGGCCTTGCACAGTTGTACTGTCTCTCGAGAGACAGTACAACTGTGCAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000139282    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_207400.1-668s1c1
Sequence:CCGGCCAAAGCCTTGCACAGTTGTACTCGAGTACAACTGTGCAAGGCTTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_207400
FLJ39739 MISSION shRNA shRNA Plasmid DNA
Human
4 Products Total
TRC Number Vector Price Set Price (4)? Select
TRCN0000144873    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_207400.1-640s1c1
Sequence:CCGGGATTCACCACTCTAATCTCTTCTCGAGAAGAGATTAGAGTGGTGAATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000140788    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_207400.1-233s1c1
Sequence:CCGGGCTAAAGGCGAGGATGGATTACTCGAGTAATCCATCCTCGCCTTTAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000139485    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_207400.1-674s1c1
Sequence:CCGGCCTTGCACAGTTGTACTGTCTCTCGAGAGACAGTACAACTGTGCAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000139282    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_207400.1-668s1c1
Sequence:CCGGCCAAAGCCTTGCACAGTTGTACTCGAGTACAACTGTGCAAGGCTTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_207400
FLJ39739 MISSION shRNA Lentiviral Transduction Particles
Human
4 Products Total
TRC Number Volume Titer Vector Price Set Price (4)? Select
TRCN0000144873    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_207400.1-640s1c1
Sequence:CCGGGATTCACCACTCTAATCTCTTCTCGAGAAGAGATTAGAGTGGTGAATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000140788    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_207400.1-233s1c1
Sequence:CCGGGCTAAAGGCGAGGATGGATTACTCGAGTAATCCATCCTCGCCTTTAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000139485    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_207400.1-674s1c1
Sequence:CCGGCCTTGCACAGTTGTACTGTCTCTCGAGAGACAGTACAACTGTGCAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000139282    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_207400.1-668s1c1
Sequence:CCGGCCAAAGCCTTGCACAGTTGTACTCGAGTACAACTGTGCAAGGCTTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-XM_371301
FLJ39739 MISSION shRNA Bacterial Glycerol Stock
Human
2 Products Total
TRC Number Price Set Price (2)? Select
TRCN0000121893    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:XM_371301.2-1431s1c1
Sequence:CCGGGCCTTATACAATGCTTCTAATCTCGAGATTAGAAGCATTGTATAAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000121894    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_371301.2-242s1c1
Sequence:CCGGGAGGATGGATTAATTCAACAACTCGAGTTGTTGAATTAATCCATCCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-XM_371301
FLJ39739 MISSION shRNA shRNA Plasmid DNA
Human
2 Products Total
TRC Number Vector Price Set Price (2)? Select
TRCN0000121893    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:XM_371301.2-1431s1c1
Sequence:CCGGGCCTTATACAATGCTTCTAATCTCGAGATTAGAAGCATTGTATAAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000121894    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_371301.2-242s1c1
Sequence:CCGGGAGGATGGATTAATTCAACAACTCGAGTTGTTGAATTAATCCATCCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-XM_371301
FLJ39739 MISSION shRNA Lentiviral Transduction Particles
Human
2 Products Total
TRC Number Volume Titer Vector Price Set Price (2)? Select
TRCN0000121893    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:XM_371301.2-1431s1c1
Sequence:CCGGGCCTTATACAATGCTTCTAATCTCGAGATTAGAAGCATTGTATAAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000121894    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_371301.2-242s1c1
Sequence:CCGGGAGGATGGATTAATTCAACAACTCGAGTTGTTGAATTAATCCATCCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks