EMAIL THIS PAGE TO A FRIEND

FLJ40194

42 Gene Product Result for
Species: Human FLJ40194(124871)
Gene ID:
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001007529 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001007529 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001007529 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001007529 Rosetta Predictions human pricing
XR_040207 Rosetta Predictions human pricing
XR_040208 Rosetta Predictions human pricing
XR_040209 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001007529 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00034009 predicted 296
2 SASI_Hs01_00034010 predicted 297
3 SASI_Hs01_00034011 predicted 224
4 SASI_Hs01_00034012 predicted 335
5 SASI_Hs01_00034013 predicted 227
6 SASI_Hs01_00034014 predicted 227
7 SASI_Hs01_00034015 predicted 279
8 SASI_Hs01_00034016 predicted 272
9 SASI_Hs01_00034017 predicted 308
10 SASI_Hs01_00034018 predicted 263
siRNA
PRODUCT # siRNA Type ? SPECIES
XR_040207 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00516879 predicted 205
2 SASI_Hs02_00516880 predicted 207
3 SASI_Hs02_00516881 predicted 206
4 SASI_Hs02_00516882 predicted 206
5 SASI_Hs02_00516883 predicted 201
6 SASI_Hs02_00516884 predicted 201
7 SASI_Hs02_00516885 predicted 388
8 SASI_Hs02_00516886 predicted 272
9 SASI_Hs02_00516887 predicted 52
10 SASI_Hs02_00516888 predicted 303
siRNA
PRODUCT # siRNA Type ? SPECIES
XR_040208 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00516889 predicted 206
2 SASI_Hs02_00516890 predicted 200
3 SASI_Hs02_00516891 predicted 202
4 SASI_Hs02_00516892 predicted 209
5 SASI_Hs02_00516893 predicted 206
6 SASI_Hs02_00516894 predicted 205
7 SASI_Hs02_00516895 predicted 391
8 SASI_Hs02_00516896 predicted 267
9 SASI_Hs02_00516897 predicted 52
10 SASI_Hs02_00516898 predicted 310
siRNA
PRODUCT # siRNA Type ? SPECIES
XR_040209 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00516899 predicted 205
2 SASI_Hs02_00516900 predicted 199
3 SASI_Hs02_00516901 predicted 201
4 SASI_Hs02_00516902 predicted 207
5 SASI_Hs02_00516903 predicted 197
6 SASI_Hs02_00516904 predicted 199
7 SASI_Hs02_00516905 predicted 390
8 SASI_Hs02_00516906 predicted 272
9 SASI_Hs02_00516907 predicted 48
10 SASI_Hs02_00516908 predicted 309
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001007529
FLJ40194 MISSION shRNA Bacterial Glycerol Stock
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000138951    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001007529.1-973s1c1
Sequence:CCGGGCAATGGATTTGAGGTGGGATCTCGAGATCCCACCTCAAATCCATTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000137318    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001007529.1-347s1c1
Sequence:CCGGGTTCCTTATCACGTACCATGACTCGAGTCATGGTACGTGATAAGGAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000133721    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001007529.1-402s1c1
Sequence:CCGGGAGATTTACAATTGCACTGCTCTCGAGAGCAGTGCAATTGTAAATCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000133783    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001007529.1-397s1c1
Sequence:CCGGCTGGTGAGATTTACAATTGCACTCGAGTGCAATTGTAAATCTCACCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000133814    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001007529.1-393s1c1
Sequence:CCGGCCTTCTGGTGAGATTTACAATCTCGAGATTGTAAATCTCACCAGAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000137745    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001007529.1-866s1c1
Sequence:CCGGGCTCCAGCTTTCTCCATTCATCTCGAGATGAATGGAGAAAGCTGGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000138334    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001007529.1-341s1c1
Sequence:CCGGCACCCAGTTCCTTATCACGTACTCGAGTACGTGATAAGGAACTGGGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000138313    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001007529.1-344s1c1
Sequence:CCGGCCAGTTCCTTATCACGTACCACTCGAGTGGTACGTGATAAGGAACTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001007529
FLJ40194 MISSION shRNA shRNA Plasmid DNA
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000138951    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001007529.1-973s1c1
Sequence:CCGGGCAATGGATTTGAGGTGGGATCTCGAGATCCCACCTCAAATCCATTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000137318    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001007529.1-347s1c1
Sequence:CCGGGTTCCTTATCACGTACCATGACTCGAGTCATGGTACGTGATAAGGAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000133721    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001007529.1-402s1c1
Sequence:CCGGGAGATTTACAATTGCACTGCTCTCGAGAGCAGTGCAATTGTAAATCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000133783    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001007529.1-397s1c1
Sequence:CCGGCTGGTGAGATTTACAATTGCACTCGAGTGCAATTGTAAATCTCACCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000133814    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001007529.1-393s1c1
Sequence:CCGGCCTTCTGGTGAGATTTACAATCTCGAGATTGTAAATCTCACCAGAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000137745    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001007529.1-866s1c1
Sequence:CCGGGCTCCAGCTTTCTCCATTCATCTCGAGATGAATGGAGAAAGCTGGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000138334    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001007529.1-341s1c1
Sequence:CCGGCACCCAGTTCCTTATCACGTACTCGAGTACGTGATAAGGAACTGGGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000138313    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001007529.1-344s1c1
Sequence:CCGGCCAGTTCCTTATCACGTACCACTCGAGTGGTACGTGATAAGGAACTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001007529
FLJ40194 MISSION shRNA Lentiviral Transduction Particles
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000138951    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001007529.1-973s1c1
Sequence:CCGGGCAATGGATTTGAGGTGGGATCTCGAGATCCCACCTCAAATCCATTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000137318    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001007529.1-347s1c1
Sequence:CCGGGTTCCTTATCACGTACCATGACTCGAGTCATGGTACGTGATAAGGAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000133721    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001007529.1-402s1c1
Sequence:CCGGGAGATTTACAATTGCACTGCTCTCGAGAGCAGTGCAATTGTAAATCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000133783    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001007529.1-397s1c1
Sequence:CCGGCTGGTGAGATTTACAATTGCACTCGAGTGCAATTGTAAATCTCACCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000133814    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001007529.1-393s1c1
Sequence:CCGGCCTTCTGGTGAGATTTACAATCTCGAGATTGTAAATCTCACCAGAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000137745    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001007529.1-866s1c1
Sequence:CCGGGCTCCAGCTTTCTCCATTCATCTCGAGATGAATGGAGAAAGCTGGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000138334    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001007529.1-341s1c1
Sequence:CCGGCACCCAGTTCCTTATCACGTACTCGAGTACGTGATAAGGAACTGGGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000138313    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001007529.1-344s1c1
Sequence:CCGGCCAGTTCCTTATCACGTACCACTCGAGTGGTACGTGATAAGGAACTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks