EMAIL THIS PAGE TO A FRIEND

FLJ40288

Species: Human FLJ40288(286023)
Gene ID:
50 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_173682 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_173682 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_173682 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_173682 Rosetta Predictions human pricing
XR_040153 Rosetta Predictions human pricing
XR_040154 Rosetta Predictions human pricing
XR_040155 Rosetta Predictions human pricing
XR_040156 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_173682 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00170513 predicted 984
2 SASI_Hs01_00170514 predicted 1015
3 SASI_Hs01_00170515 predicted 1087
4 SASI_Hs01_00170516 predicted 1173
5 SASI_Hs01_00170517 predicted 1501
6 SASI_Hs01_00170518 predicted 920
7 SASI_Hs01_00170519 predicted 1298
8 SASI_Hs01_00170520 predicted 1171
9 SASI_Hs01_00170521 predicted 978
10 SASI_Hs01_00170522 predicted 858
siRNA
PRODUCT # siRNA Type ? SPECIES
XR_040153 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00516388 predicted 212
2 SASI_Hs02_00516389 predicted 213
3 SASI_Hs02_00516390 predicted 214
4 SASI_Hs02_00516391 predicted 208
5 SASI_Hs02_00516392 predicted 211
6 SASI_Hs02_00516393 predicted 209
7 SASI_Hs02_00516394 predicted 353
8 SASI_Hs02_00516395 predicted 292
9 SASI_Hs02_00516396 predicted 388
10 SASI_Hs02_00516397 predicted 38
siRNA
PRODUCT # siRNA Type ? SPECIES
XR_040154 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00516398 predicted 212
2 SASI_Hs02_00516399 predicted 217
3 SASI_Hs02_00516400 predicted 213
4 SASI_Hs02_00516401 predicted 211
5 SASI_Hs02_00516402 predicted 205
6 SASI_Hs02_00516403 predicted 210
7 SASI_Hs02_00516404 predicted 359
8 SASI_Hs02_00516405 predicted 289
9 SASI_Hs02_00516406 predicted 391
10 SASI_Hs02_00516407 predicted 31
siRNA
PRODUCT # siRNA Type ? SPECIES
XR_040155 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00516408 predicted 209
2 SASI_Hs02_00516409 predicted 211
3 SASI_Hs02_00516410 predicted 213
4 SASI_Hs02_00516411 predicted 217
5 SASI_Hs02_00516412 predicted 206
6 SASI_Hs02_00516413 predicted 203
7 SASI_Hs02_00516414 predicted 355
8 SASI_Hs02_00516415 predicted 293
9 SASI_Hs02_00516416 predicted 387
10 SASI_Hs02_00516417 predicted 35
siRNA
PRODUCT # siRNA Type ? SPECIES
XR_040156 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00516418 predicted 211
2 SASI_Hs02_00516419 predicted 214
3 SASI_Hs02_00516420 predicted 210
4 SASI_Hs02_00516421 predicted 208
5 SASI_Hs02_00516422 predicted 205
6 SASI_Hs02_00516423 predicted 206
7 SASI_Hs02_00516424 predicted 356
8 SASI_Hs02_00516425 predicted 286
9 SASI_Hs02_00516426 predicted 394
10 SASI_Hs02_00516427 predicted 32
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_173682
FLJ40288 MISSION shRNA Bacterial Glycerol Stock
Human
6 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000168457    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_173682.1-937s1c1
Sequence:CCGGGTCTTTGGGATTCTCAACATTCTCGAGAATGTTGAGAATCCCAAAGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000167560    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_173682.1-1390s1c1
Sequence:CCGGGAGAGTAAACATTGTCACATTCTCGAGAATGTGACAATGTTTACTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000168312    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_173682.1-651s1c1
Sequence:CCGGGAAATGCCCATGGTTTGTATACTCGAGTATACAAACCATGGGCATTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000168245    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_173682.1-733s1c1
Sequence:CCGGCTTTATCTTCATTCTGAGCTGCTCGAGCAGCTCAGAATGAAGATAAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000172596    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_173682.1-1009s1c1
Sequence:CCGGGAAACAGAGTCAAGTGCCGTACTCGAGTACGGCACTTGACTCTGTTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000168582    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_173682.1-679s1c1
Sequence:CCGGGAGAGACCAATTTCAAGAGAACTCGAGTTCTCTTGAAATTGGTCTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_173682
FLJ40288 MISSION shRNA shRNA Plasmid DNA
Human
6 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000168457    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_173682.1-937s1c1
Sequence:CCGGGTCTTTGGGATTCTCAACATTCTCGAGAATGTTGAGAATCCCAAAGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000167560    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_173682.1-1390s1c1
Sequence:CCGGGAGAGTAAACATTGTCACATTCTCGAGAATGTGACAATGTTTACTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000168312    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_173682.1-651s1c1
Sequence:CCGGGAAATGCCCATGGTTTGTATACTCGAGTATACAAACCATGGGCATTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000168245    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_173682.1-733s1c1
Sequence:CCGGCTTTATCTTCATTCTGAGCTGCTCGAGCAGCTCAGAATGAAGATAAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000172596    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_173682.1-1009s1c1
Sequence:CCGGGAAACAGAGTCAAGTGCCGTACTCGAGTACGGCACTTGACTCTGTTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000168582    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_173682.1-679s1c1
Sequence:CCGGGAGAGACCAATTTCAAGAGAACTCGAGTTCTCTTGAAATTGGTCTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_173682
FLJ40288 MISSION shRNA Lentiviral Transduction Particles
Human
6 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000168457    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_173682.1-937s1c1
Sequence:CCGGGTCTTTGGGATTCTCAACATTCTCGAGAATGTTGAGAATCCCAAAGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000167560    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_173682.1-1390s1c1
Sequence:CCGGGAGAGTAAACATTGTCACATTCTCGAGAATGTGACAATGTTTACTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000168312    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_173682.1-651s1c1
Sequence:CCGGGAAATGCCCATGGTTTGTATACTCGAGTATACAAACCATGGGCATTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000168245    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_173682.1-733s1c1
Sequence:CCGGCTTTATCTTCATTCTGAGCTGCTCGAGCAGCTCAGAATGAAGATAAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000172596    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_173682.1-1009s1c1
Sequence:CCGGGAAACAGAGTCAAGTGCCGTACTCGAGTACGGCACTTGACTCTGTTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000168582    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_173682.1-679s1c1
Sequence:CCGGGAGAGACCAATTTCAAGAGAACTCGAGTTCTCTTGAAATTGGTCTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks