EMAIL THIS PAGE TO A FRIEND

FLJ40448

40 Gene Product Result for
Species: Human FLJ40448(339059)
Gene ID:
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_182605 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_182605 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_182605 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_182605 Rosetta Predictions human pricing
XR_039971 Rosetta Predictions human pricing
XR_039972 Rosetta Predictions human pricing
XR_039973 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_182605 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00146146 predicted 739
2 SASI_Hs01_00146147 predicted 926
3 SASI_Hs01_00146148 predicted 569
4 SASI_Hs01_00146149 predicted 482
5 SASI_Hs01_00146150 predicted 534
6 SASI_Hs01_00146151 predicted 984
7 SASI_Hs01_00146152 predicted 317
8 SASI_Hs01_00146153 predicted 912
9 SASI_Hs01_00146154 predicted 492
10 SASI_Hs01_00146155 predicted 739
siRNA
PRODUCT # siRNA Type ? SPECIES
XR_039971 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00514741 predicted 474
2 SASI_Hs02_00514742 predicted 476
3 SASI_Hs02_00514743 predicted 531
4 SASI_Hs02_00514744 predicted 396
5 SASI_Hs02_00514745 predicted 487
6 SASI_Hs02_00514746 predicted 479
7 SASI_Hs02_00514747 predicted 389
8 SASI_Hs02_00514748 predicted 199
9 SASI_Hs02_00514749 predicted 219
10 SASI_Hs02_00514750 predicted 476
siRNA
PRODUCT # siRNA Type ? SPECIES
XR_039972 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00514751 predicted 466
2 SASI_Hs02_00514752 predicted 474
3 SASI_Hs02_00514753 predicted 526
4 SASI_Hs02_00514754 predicted 399
5 SASI_Hs02_00514755 predicted 487
6 SASI_Hs02_00514756 predicted 487
7 SASI_Hs02_00514757 predicted 392
8 SASI_Hs02_00514758 predicted 243
9 SASI_Hs02_00514759 predicted 215
10 SASI_Hs02_00514760 predicted 479
siRNA
PRODUCT # siRNA Type ? SPECIES
XR_039973 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00514761 predicted 470
2 SASI_Hs02_00514762 predicted 471
3 SASI_Hs02_00514763 predicted 530
4 SASI_Hs02_00514764 predicted 394
5 SASI_Hs02_00514765 predicted 486
6 SASI_Hs02_00514766 predicted 486
7 SASI_Hs02_00514767 predicted 392
8 SASI_Hs02_00514768 predicted 192
9 SASI_Hs02_00514769 predicted 220
10 SASI_Hs02_00514770 predicted 476
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_182605
FLJ40448 MISSION shRNA Bacterial Glycerol Stock
Human
3 Products Total
TRC Number Price Set Price (3)? Select
TRCN0000180257    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_182605.1-1486s1c1
Sequence:CCGGCCCAAATGCAAAGCTGGGAAACTCGAGTTTCCCAGCTTTGCATTTGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000179120    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_182605.1-1947s1c1
Sequence:CCGGCAACATGGTGAAACCCTGTTTCTCGAGAAACAGGGTTTCACCATGTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000179121    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_182605.1-1950s1c1
Sequence:CCGGCATGGTGAAACCCTGTTTCTACTCGAGTAGAAACAGGGTTTCACCATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_182605
FLJ40448 MISSION shRNA shRNA Plasmid DNA
Human
3 Products Total
TRC Number Vector Price Set Price (3)? Select
TRCN0000180257    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_182605.1-1486s1c1
Sequence:CCGGCCCAAATGCAAAGCTGGGAAACTCGAGTTTCCCAGCTTTGCATTTGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000179120    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_182605.1-1947s1c1
Sequence:CCGGCAACATGGTGAAACCCTGTTTCTCGAGAAACAGGGTTTCACCATGTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000179121    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_182605.1-1950s1c1
Sequence:CCGGCATGGTGAAACCCTGTTTCTACTCGAGTAGAAACAGGGTTTCACCATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_182605
FLJ40448 MISSION shRNA Lentiviral Transduction Particles
Human
3 Products Total
TRC Number Volume Titer Vector Price Set Price (3)? Select
TRCN0000180257    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_182605.1-1486s1c1
Sequence:CCGGCCCAAATGCAAAGCTGGGAAACTCGAGTTTCCCAGCTTTGCATTTGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000179120    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_182605.1-1947s1c1
Sequence:CCGGCAACATGGTGAAACCCTGTTTCTCGAGAAACAGGGTTTCACCATGTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000179121    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_182605.1-1950s1c1
Sequence:CCGGCATGGTGAAACCCTGTTTCTACTCGAGTAGAAACAGGGTTTCACCATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks