EMAIL THIS PAGE TO A FRIEND

FLJ40712

20 Gene Product Result for
Species: Human FLJ40712(401044)
Gene ID:
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_207484 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_207484 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_207484 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
XR_041565 Rosetta Predictions human pricing
XR_041566 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
XR_041565 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00528421 predicted 296
2 SASI_Hs02_00528422 predicted 295
3 SASI_Hs02_00528423 predicted 265
4 SASI_Hs02_00528424 predicted 244
5 SASI_Hs02_00528425 predicted 202
6 SASI_Hs02_00528426 predicted 199
7 SASI_Hs02_00528427 predicted 206
8 SASI_Hs02_00528428 predicted 253
9 SASI_Hs02_00528429 predicted 212
10 SASI_Hs02_00528430 predicted 309
siRNA
PRODUCT # siRNA Type ? SPECIES
XR_041566 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00528431 predicted 292
2 SASI_Hs02_00528432 predicted 292
3 SASI_Hs02_00528433 predicted 262
4 SASI_Hs02_00528434 predicted 248
5 SASI_Hs02_00528435 predicted 203
6 SASI_Hs02_00528436 predicted 203
7 SASI_Hs02_00528437 predicted 251
8 SASI_Hs02_00528438 predicted 208
9 SASI_Hs02_00528439 predicted 205
10 SASI_Hs02_00528440 predicted 310
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_207484
FLJ40712 MISSION shRNA Bacterial Glycerol Stock
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000154290    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_207484.1-1887s1c1
Sequence:CCGGGTCGTGTGTATAATGTGGCAACTCGAGTTGCCACATTATACACACGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000153678    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_207484.1-637s1c1
Sequence:CCGGCCGCGTTCTCAAGATATTCTTCTCGAGAAGAATATCTTGAGAACGCGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000151242    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_207484.1-1504s1c1
Sequence:CCGGGAAGCAAACAACCTGATGTTTCTCGAGAAACATCAGGTTGTTTGCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000151576    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_207484.1-1500s1c1
Sequence:CCGGGAATGAAGCAAACAACCTGATCTCGAGATCAGGTTGTTTGCTTCATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000153621    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_207484.1-1081s1c1
Sequence:CCGGCTGAGAACTTTCCAGAAGGTTCTCGAGAACCTTCTGGAAAGTTCTCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000158177    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_207484.1-699s1c1
Sequence:CCGGCCTTTCAGAGTACTCGGAGATCTCGAGATCTCCGAGTACTCTGAAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000156819    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_207484.1-211s1c1
Sequence:CCGGGAGACCAGGTTACCTTCCTTTCTCGAGAAAGGAAGGTAACCTGGTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000156696    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_207484.1-1080s1c1
Sequence:CCGGGCTGAGAACTTTCCAGAAGGTCTCGAGACCTTCTGGAAAGTTCTCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000157139    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_207484.1-445s1c1
Sequence:CCGGGCTCTGTGTTTGTGGAAACCACTCGAGTGGTTTCCACAAACACAGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000157973    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_207484.1-441s1c1
Sequence:CCGGCTCTGCTCTGTGTTTGTGGAACTCGAGTTCCACAAACACAGAGCAGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_207484
FLJ40712 MISSION shRNA shRNA Plasmid DNA
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000154290    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_207484.1-1887s1c1
Sequence:CCGGGTCGTGTGTATAATGTGGCAACTCGAGTTGCCACATTATACACACGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000153678    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_207484.1-637s1c1
Sequence:CCGGCCGCGTTCTCAAGATATTCTTCTCGAGAAGAATATCTTGAGAACGCGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000151242    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_207484.1-1504s1c1
Sequence:CCGGGAAGCAAACAACCTGATGTTTCTCGAGAAACATCAGGTTGTTTGCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000151576    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_207484.1-1500s1c1
Sequence:CCGGGAATGAAGCAAACAACCTGATCTCGAGATCAGGTTGTTTGCTTCATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000153621    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_207484.1-1081s1c1
Sequence:CCGGCTGAGAACTTTCCAGAAGGTTCTCGAGAACCTTCTGGAAAGTTCTCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000158177    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_207484.1-699s1c1
Sequence:CCGGCCTTTCAGAGTACTCGGAGATCTCGAGATCTCCGAGTACTCTGAAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000156819    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_207484.1-211s1c1
Sequence:CCGGGAGACCAGGTTACCTTCCTTTCTCGAGAAAGGAAGGTAACCTGGTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000156696    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_207484.1-1080s1c1
Sequence:CCGGGCTGAGAACTTTCCAGAAGGTCTCGAGACCTTCTGGAAAGTTCTCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000157139    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_207484.1-445s1c1
Sequence:CCGGGCTCTGTGTTTGTGGAAACCACTCGAGTGGTTTCCACAAACACAGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000157973    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_207484.1-441s1c1
Sequence:CCGGCTCTGCTCTGTGTTTGTGGAACTCGAGTTCCACAAACACAGAGCAGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_207484
FLJ40712 MISSION shRNA Lentiviral Transduction Particles
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000154290    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_207484.1-1887s1c1
Sequence:CCGGGTCGTGTGTATAATGTGGCAACTCGAGTTGCCACATTATACACACGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000153678    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_207484.1-637s1c1
Sequence:CCGGCCGCGTTCTCAAGATATTCTTCTCGAGAAGAATATCTTGAGAACGCGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000151242    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_207484.1-1504s1c1
Sequence:CCGGGAAGCAAACAACCTGATGTTTCTCGAGAAACATCAGGTTGTTTGCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000151576    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_207484.1-1500s1c1
Sequence:CCGGGAATGAAGCAAACAACCTGATCTCGAGATCAGGTTGTTTGCTTCATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000153621    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_207484.1-1081s1c1
Sequence:CCGGCTGAGAACTTTCCAGAAGGTTCTCGAGAACCTTCTGGAAAGTTCTCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000158177    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_207484.1-699s1c1
Sequence:CCGGCCTTTCAGAGTACTCGGAGATCTCGAGATCTCCGAGTACTCTGAAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000156819    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_207484.1-211s1c1
Sequence:CCGGGAGACCAGGTTACCTTCCTTTCTCGAGAAAGGAAGGTAACCTGGTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000156696    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_207484.1-1080s1c1
Sequence:CCGGGCTGAGAACTTTCCAGAAGGTCTCGAGACCTTCTGGAAAGTTCTCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000157139    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_207484.1-445s1c1
Sequence:CCGGGCTCTGTGTTTGTGGAAACCACTCGAGTGGTTTCCACAAACACAGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000157973    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_207484.1-441s1c1
Sequence:CCGGCTCTGCTCTGTGTTTGTGGAACTCGAGTTCCACAAACACAGAGCAGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks