EMAIL THIS PAGE TO A FRIEND

FLJ41170

40 Gene Product Result for
Species: Human FLJ41170(440200)
Gene ID:
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001004332 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001004332 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001004332 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001004332 Rosetta Predictions human pricing
XR_041854 Rosetta Predictions human pricing
XR_041855 Rosetta Predictions human pricing
XR_041856 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001004332 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00148695 predicted 1121
2 SASI_Hs01_00148696 predicted 1028
3 SASI_Hs01_00148697 predicted 1126
4 SASI_Hs01_00148698 predicted 1123
5 SASI_Hs01_00148699 predicted 1122
6 SASI_Hs01_00148700 predicted 1057
7 SASI_Hs01_00148701 predicted 789
8 SASI_Hs01_00148702 predicted 1184
9 SASI_Hs01_00148703 predicted 1205
10 SASI_Hs01_00148704 predicted 836
siRNA
PRODUCT # siRNA Type ? SPECIES
XR_041854 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00530912 predicted 1016
2 SASI_Hs02_00530913 predicted 1119
3 SASI_Hs02_00530914 predicted 1115
4 SASI_Hs02_00530915 predicted 1113
5 SASI_Hs02_00530916 predicted 947
6 SASI_Hs02_00530917 predicted 1159
7 SASI_Hs02_00530918 predicted 1072
8 SASI_Hs02_00530919 predicted 787
9 SASI_Hs02_00530920 predicted 1147
10 SASI_Hs02_00530921 predicted 928
siRNA
PRODUCT # siRNA Type ? SPECIES
XR_041855 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00530922 predicted 1019
2 SASI_Hs02_00530923 predicted 1116
3 SASI_Hs02_00530924 predicted 1121
4 SASI_Hs02_00530925 predicted 1111
5 SASI_Hs02_00530926 predicted 954
6 SASI_Hs02_00530927 predicted 1164
7 SASI_Hs02_00530928 predicted 1067
8 SASI_Hs02_00530929 predicted 786
9 SASI_Hs02_00530930 predicted 1150
10 SASI_Hs02_00530931 predicted 927
siRNA
PRODUCT # siRNA Type ? SPECIES
XR_041856 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00530932 predicted 1018
2 SASI_Hs02_00530933 predicted 1123
3 SASI_Hs02_00530934 predicted 1121
4 SASI_Hs02_00530935 predicted 1111
5 SASI_Hs02_00530936 predicted 1159
6 SASI_Hs02_00530937 predicted 1065
7 SASI_Hs02_00530938 predicted 786
8 SASI_Hs02_00530939 predicted 1146
9 SASI_Hs02_00530940 predicted 933
10 SASI_Hs02_00530941 predicted 884
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001004332
FLJ41170 MISSION shRNA Bacterial Glycerol Stock
Human
11 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000138787    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001004332.1-842s1c1
Sequence:CCGGGCACTGATGATGAGCACATGTCTCGAGACATGTGCTCATCATCAGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000135032    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001004332.1-723s1c1
Sequence:CCGGCTGATCTCTGTTCTTGGTTAACTCGAGTTAACCAAGAACAGAGATCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000134334    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001004332.1-732s1c1
Sequence:CCGGGTTCTTGGTTAAGTTCCAAGACTCGAGTCTTGGAACTTAACCAAGAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000133720    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001004332.1-1275s1c1
Sequence:CCGGGAGAGGAAAGATGTTTCCATTCTCGAGAATGGAAACATCTTTCCTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000134183    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001004332.1-1131s1c1
Sequence:CCGGCCTTCTTGAAGAGAGACATTTCTCGAGAAATGTCTCTCTTCAAGAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000134219    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001004332.1-744s1c1
Sequence:CCGGGTTCCAAGAACCATCTAAGTTCTCGAGAACTTAGATGGTTCTTGGAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000134597    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001004332.1-739s1c1
Sequence:CCGGGTTAAGTTCCAAGAACCATCTCTCGAGAGATGGTTCTTGGAACTTAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000135522    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001004332.1-711s1c1
Sequence:CCGGCCAGGAAAGATACTGATCTCTCTCGAGAGAGATCAGTATCTTTCCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000138490    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001004332.1-658s1c1
Sequence:CCGGCAGGAGGATTCAAGGTGTCTTCTCGAGAAGACACCTTGAATCCTCCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000138569    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001004332.1-586s1c1
Sequence:CCGGCTCACAACTGGCTATCCCTATCTCGAGATAGGGATAGCCAGTTGTGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000138695    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001004332.1-971s1c1
Sequence:CCGGGCAGGAAGGCATCTCATGAAACTCGAGTTTCATGAGATGCCTTCCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001004332
FLJ41170 MISSION shRNA shRNA Plasmid DNA
Human
11 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000138787    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001004332.1-842s1c1
Sequence:CCGGGCACTGATGATGAGCACATGTCTCGAGACATGTGCTCATCATCAGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000135032    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001004332.1-723s1c1
Sequence:CCGGCTGATCTCTGTTCTTGGTTAACTCGAGTTAACCAAGAACAGAGATCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000134334    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001004332.1-732s1c1
Sequence:CCGGGTTCTTGGTTAAGTTCCAAGACTCGAGTCTTGGAACTTAACCAAGAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000133720    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001004332.1-1275s1c1
Sequence:CCGGGAGAGGAAAGATGTTTCCATTCTCGAGAATGGAAACATCTTTCCTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000134183    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001004332.1-1131s1c1
Sequence:CCGGCCTTCTTGAAGAGAGACATTTCTCGAGAAATGTCTCTCTTCAAGAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000134219    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001004332.1-744s1c1
Sequence:CCGGGTTCCAAGAACCATCTAAGTTCTCGAGAACTTAGATGGTTCTTGGAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000134597    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001004332.1-739s1c1
Sequence:CCGGGTTAAGTTCCAAGAACCATCTCTCGAGAGATGGTTCTTGGAACTTAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000135522    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001004332.1-711s1c1
Sequence:CCGGCCAGGAAAGATACTGATCTCTCTCGAGAGAGATCAGTATCTTTCCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000138490    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001004332.1-658s1c1
Sequence:CCGGCAGGAGGATTCAAGGTGTCTTCTCGAGAAGACACCTTGAATCCTCCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000138569    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001004332.1-586s1c1
Sequence:CCGGCTCACAACTGGCTATCCCTATCTCGAGATAGGGATAGCCAGTTGTGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000138695    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001004332.1-971s1c1
Sequence:CCGGGCAGGAAGGCATCTCATGAAACTCGAGTTTCATGAGATGCCTTCCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001004332
FLJ41170 MISSION shRNA Lentiviral Transduction Particles
Human
11 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000138787    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001004332.1-842s1c1
Sequence:CCGGGCACTGATGATGAGCACATGTCTCGAGACATGTGCTCATCATCAGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000135032    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001004332.1-723s1c1
Sequence:CCGGCTGATCTCTGTTCTTGGTTAACTCGAGTTAACCAAGAACAGAGATCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000134334    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001004332.1-732s1c1
Sequence:CCGGGTTCTTGGTTAAGTTCCAAGACTCGAGTCTTGGAACTTAACCAAGAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000133720    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001004332.1-1275s1c1
Sequence:CCGGGAGAGGAAAGATGTTTCCATTCTCGAGAATGGAAACATCTTTCCTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000134183    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001004332.1-1131s1c1
Sequence:CCGGCCTTCTTGAAGAGAGACATTTCTCGAGAAATGTCTCTCTTCAAGAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000134219    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001004332.1-744s1c1
Sequence:CCGGGTTCCAAGAACCATCTAAGTTCTCGAGAACTTAGATGGTTCTTGGAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000134597    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001004332.1-739s1c1
Sequence:CCGGGTTAAGTTCCAAGAACCATCTCTCGAGAGATGGTTCTTGGAACTTAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000135522    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001004332.1-711s1c1
Sequence:CCGGCCAGGAAAGATACTGATCTCTCTCGAGAGAGATCAGTATCTTTCCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000138490    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001004332.1-658s1c1
Sequence:CCGGCAGGAGGATTCAAGGTGTCTTCTCGAGAAGACACCTTGAATCCTCCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000138569    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001004332.1-586s1c1
Sequence:CCGGCTCACAACTGGCTATCCCTATCTCGAGATAGGGATAGCCAGTTGTGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000138695    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001004332.1-971s1c1
Sequence:CCGGGCAGGAAGGCATCTCATGAAACTCGAGTTTCATGAGATGCCTTCCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks